Eukaryotes January 2014 www.njctl.org Slide 3 / 143 Slide 4 / 143 - - PDF document

eukaryotes
SMART_READER_LITE
LIVE PREVIEW

Eukaryotes January 2014 www.njctl.org Slide 3 / 143 Slide 4 / 143 - - PDF document

Slide 1 / 143 Slide 2 / 143 Eukaryotes January 2014 www.njctl.org Slide 3 / 143 Slide 4 / 143 Vocabulary Vocabulary Click on each word below to go to the definition. Click on each word below to go to the definition. 5' cap exocytosis


slide-1
SLIDE 1

Slide 1 / 143 Slide 2 / 143

www.njctl.org

Eukaryotes

January 2014 Slide 3 / 143 Vocabulary

alternative splicing central vacuole cell junction chitin adhering junction contractile vacuole chromatin modifying enzyme chloroplast chromatin cytoskeleton endocytosis eukaryote endosymbiosis 5' cap exocytosis exon extracellular matrix food vacuole fungi gap junction glycoprotein golgi appartus histone intermediate filament intermembrane space intron lumen lysosome endomembrane system hydrolytic enzyme Click on each word below to go to the definition.

Slide 4 / 143 Vocabulary

microtubule mRNA processing mitochondrion nuclear envelope microfilament nucleus nucleosome nuclear pore nucleolus

  • rganelle

peroxisome plasmodesmata pinocytosis matrix poly-A tail pre-mRNA protist receptor-mediated endocytosis RNA splicing rough endoplasmic reticulum smooth endoplasmic reticulum stroma tight junction transport vesicle turgor pressure phagocytosis transcription factor Click on each word below to go to the definition.

Slide 5 / 143 Eukaryotes Unit Topics

· The Eukaryotic Cell · The Nucleus & Gene Expression

Click on the topic to go to that section

· Other Organelles & Cell Structures · The Endomembrane System · Energy-Converting Organelles

Slide 6 / 143

The Eukaryotic Cell

Return to Table of Contents

slide-2
SLIDE 2

Slide 7 / 143

All cells have 4 things in common. · They are surrounded by a plasma membrane (or cell membrane). · They contain a semifluid substance called the cytosol/cytoplasm. · They contain structures called chromosomes, which carry the cell's genes. · They have ribosomes, which assemble amino acids into proteins.

All Cells Slide 8 / 143

There are 3 key differences between prokaryotic and eukaryotic cells. · Eukaryotic cells are usually larger than prokaryotic cells. · Eukaryotic cells have small compartments inside them call organelles. · Most eukaryotes (but not all) are multi-cellular

  • rganisms.

Eukaryotes vs. Prokaryotes Slide 9 / 143

1Which is NOT a basic feature of all cells? A All cells are surrounded by a plasma membrane. B Al cells contain a semifluid substance called the cytoplasm. C All cells contain structures called chromosomes, which are contained in the nucleus. D All cells have ribosomes.

Slide 9 (Answer) / 143

1Which is NOT a basic feature of all cells? A All cells are surrounded by a plasma membrane. B Al cells contain a semifluid substance called the cytoplasm. C All cells contain structures called chromosomes, which are contained in the nucleus. D All cells have ribosomes.

[This object is a pull tab]

Answer C

Slide 10 / 143

Animal Cell (Eukaryote) Bacterium (Prokaryote)

Eukaryotic cells are, on average, much larger than prokaryotic

  • cells. The average diameter of most prokaryotic cells is between

1 and 10µm. By contrast, most eukaryotic cells are between 5 to 100µm in diameter.

Cell Size Slide 11 / 143 Surface Area to Volume Ratio

At the time when prokaryotic cells were evolving, there were most likely different sizes of cells. A cell's efficiency and ability to survive depended

  • n its surface area to volume ratio.

The volume of the cell determines the amount of chemical activity it can carry out per unit time. The surface area of the cell determines the amount of substances the cell can take in from the environment and the amount of waste it can release. As a cell grows in size, it's surface area to volume ratio decreases. It performs chemical reactions faster, but it has a harder time getting nutrients in and waste out.

slide-3
SLIDE 3

Slide 12 / 143

We know that cells need to be small enough so that they have an increased surface area to volume ratio, but be large enough to perform the chemical reactions of metabolism.

Most Efficient Least Efficient

The smaller the cell, the larger its surface area and the smaller its volume.

Limits of Cell Size

The bigger the cell, the smaller the surface area is compared to its large volume inside.

Slide 13 / 143 Organelles

To increase efficiency in the larger cell, eukaryotes evolved many bacterium-sized parts known as organelles. Organelles subdivide the cell into specialized compartments. They play many important roles in the cell. Some transport waste to the cell membrane. Others keep the molecules required for specific chemical reactions located within a certain compartment so they do not need to diffuse long distances to be useful.

Slide 14 / 143

Organelles making up Eukaryotic cells include:

Organelles

· Nucleus · Lysosomes · Ribosomes · Peroxisomes · Mitochondria · Vacuoles · Smooth Endoplasmic Reticulum · Rough Endoplasmic Reticulum · Chloroplasts · Golgi Apparatus

Slide 15 / 143 Multicellular Organisms

Even with organelles, the size of the cell is limited to about 1000µm3. This is why large organisms must consist of many smaller cells.

Slide 16 / 143

Diversity of Eukaryotes Protists: The first eukaryotic cells. Protists are single-celled eukaryotes. They range from protozoans to algae. Fungi: These organisms evolved second in time along with

  • plants. Examples include mushrooms, molds, and mildews.

Plants: Plants vary in type from the first plants called mosses to the modern flowering plants. Animals : Animals were the last eukaryotes to evolve. Animals range from ancient sponges and hydra to primates.

Slide 17 / 143

2Which of the following are prokaryotic cells? A Plants B Fungi C Bacteria D Animals

slide-4
SLIDE 4

Slide 17 (Answer) / 143

2Which of the following are prokaryotic cells? A Plants B Fungi C Bacteria D Animals

[This object is a pull tab]

Answer C

Slide 18 / 143

3 How did eukaryotes solve the problem of small surface area to volume ratio? A by remaining the same size as prokaryotes B by becoming multicellular organisms C by compartmentalizing functions into organelles D they haven't solved the problem

Slide 18 (Answer) / 143

3 How did eukaryotes solve the problem of small surface area to volume ratio? A by remaining the same size as prokaryotes B by becoming multicellular organisms C by compartmentalizing functions into organelles D they haven't solved the problem

[This object is a pull tab]

Answer C

Slide 19 / 143

4 All eukaryotes are multi-cellular.

True False

Slide 19 (Answer) / 143

4 All eukaryotes are multi-cellular.

True False

[This object is a pull tab]

Answer False

Slide 20 / 143

The Nucleus & Gene Expression

Return to Table of Contents

slide-5
SLIDE 5

Slide 21 / 143

prokaryotes: pro: before karyon: kernel/seed (nucleus)

The Nucleus

eukaryote: eu: true karyon: kernel/seed (nucleus) So prokaryote = "before a nucleus" And eukaryote = "true nucleus"

The defining organelle in eukaryotic cell is the nucleus. The nucleus of the cell contains the DNA and controls the cell's activities by directing protein synthesis from DNA.

Slide 22 / 143

The nucleus from chemistry with protons and neutrons is not the same nucleus involved with cells. The biological nucleus is usually, but not always, in the center of a cell and it is sometimes referred to as the "control center" of the cell.

The Biological Nucleus

Biological Nucleus

Slide 23 / 143 Inside the Nucleus

The nucleus is enclosed by a double cell membrane structure called the nuclear envelope. The nuclear envelope has many

  • penings called nuclear pores.

Nuclear pores help the nucleus "communicate" with other parts of the cell. Inside the nucleus is a dense region known as the nucleolus. The nucleolus is where rRNA is made and ribosomes are

  • assembled. They then exit through the nuclear pores.

Slide 24 / 143 3 Main Functions of the Nucleus

  • 1. To keep and contain a safe copy of all chromosomes (DNA)

and pass them on to daughter cells in cell division.

  • 2. To assemble ribosomes (specifically in the nucleolus).
  • 3. To copy DNA instructions into RNA (via transcription).

Slide 25 / 143

5Cells that contain a "true nucleus" and other membrane bound

  • rganelles are _______________.

A archaea. B bacteria. C eukaryotes. D prokaryotes.

Slide 25 (Answer) / 143

5Cells that contain a "true nucleus" and other membrane bound

  • rganelles are _______________.

A archaea. B bacteria. C eukaryotes. D prokaryotes.

[This object is a pull tab]

Answer C

slide-6
SLIDE 6

Slide 26 / 143

6 Where is the DNA of a eukaryote found? A Nucleus B Nucleolus C Nucleoid D Mitochondria

Slide 26 (Answer) / 143

6 Where is the DNA of a eukaryote found? A Nucleus B Nucleolus C Nucleoid D Mitochondria

[This object is a pull tab]

Answer A

Slide 27 / 143

7 How does the nucleus control the activities of the cell? A By making DNA.

B By directing protein synthesis.

C By allowing DNA to leave the nucleus to make proteins. D By sending instructions to the mitochondria.

Slide 27 (Answer) / 143

7 How does the nucleus control the activities of the cell? A By making DNA.

B By directing protein synthesis.

C By allowing DNA to leave the nucleus to make proteins. D By sending instructions to the mitochondria.

[This object is a pull tab]

Answer B

Slide 28 / 143 Many Cells = Same DNA

All cells in a multicellular eukaryote contain the same genome. Every cell has all the genes necessary to make all parts of the organism. Cells become specialized by only expressing (turning on) certain genes, a small fraction of all the genes in the genome.

These muscle cells and brain cells (neurons) have the same DNA but they are expressing different genes, that is why their structure and function are so different.

Slide 29 / 143

Transcription and translation occur in Eukaryotes the same as in Prokaryotes, but there are extra steps that help regulate expression.

Transcription and Translation

Transcription

slide-7
SLIDE 7

Slide 30 / 143 Gene Expression in Prokaryotes

Gene expression is regulated using

  • perons that turn

genes on and off depending on the chemical environment

  • f the cell.

Slide 31 / 143 Gene Expression in Eukaryotes Overview

Eukaryotes have much more complex chromosomes that require multiple levels of regulation including: · "unpacking" of genes · transcription factors · RNA processing

Slide 32 / 143

8A particular triplet of bases in the template strand of DNA is

  • AGT. The corresponding codon for the mRNA transcribed is

A AGT. B UGA. C TCA. D ACU. E UCA

Slide 32 (Answer) / 143

8A particular triplet of bases in the template strand of DNA is

  • AGT. The corresponding codon for the mRNA transcribed is

A AGT. B UGA. C TCA. D ACU. E UCA

[This object is a pull tab]

Answer E

Slide 33 / 143

9 A codon A consists of two nucleotides. B may code for the same amino acid as another codon. C consists of discrete amino acid regions. D catalyzes RNA synthesis. E is found in all eukaryotes, but not in prokaryotes.

Slide 33 (Answer) / 143

9 A codon A consists of two nucleotides. B may code for the same amino acid as another codon. C consists of discrete amino acid regions. D catalyzes RNA synthesis. E is found in all eukaryotes, but not in prokaryotes.

[This object is a pull tab]

Answer B

slide-8
SLIDE 8

Slide 34 / 143

10If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for A leucine. B valine. C cystine. D phenylalanine. E proline.

Slide 34 (Answer) / 143

10If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for A leucine. B valine. C cystine. D phenylalanine. E proline.

[This object is a pull tab]

Answer E

Slide 35 / 143 Chromosomes

DNA is configured into structures called chromosomes. Recall that prokaryotes have

  • ne chromosome that is

double-stranded and circular. The number of chromosomes a eukaryote has depends on the species. These chromosomes are made up of a complex of tightly coiled DNA and associated proteins called chromatin.

Species Chromosome # Adders-tongue (a fern) 1440 Dog 78 Human 46 Rat 42 Pig 38 Cat 38 Rice 24 Slime Mold 12 Jack Jumper Ant 2*

*2 for females, 1 for males

Source: Wikipedia.com

Slide 36 / 143 Chromatin

The DNA is tightly wound around proteins called histones, like thread wrapped on a spool. The combination of eight histones and DNA is called a nucleosome.

Video on how DNA is packaged

Slide 37 / 143 Chromatin's Role in Gene Expression

When DNA is packed in chromatin it is not accessible to RNA polymerase so transcription can not happen. The main factor in the specialization of cells in multi-cellular

  • rganisms is what genes are "unpacked" from the chromatin to be

exposed to RNA polymerase.

All gene sequences are exposed to RNA polymerase Some genes exposed No genes exposed

Slide 38 / 143 Chromatin Modifying Enzymes

The genes that need to be expressed are unwound from histones by chromatin modifying enzymes in order to expose their nucleotide sequences. Genes that are unnecessary to a particular cell will remain packed while the neccessary ones are unpacked.

slide-9
SLIDE 9

Slide 39 / 143

11 No two cells in the human body have exactly the same DNA. True False

Slide 39 (Answer) / 143

11 No two cells in the human body have exactly the same DNA. True False

[This object is a pull tab]

Answer False

Slide 40 / 143

12 How many spools of DNA and proteins make a nucleosome?

Slide 40 (Answer) / 143

12 How many spools of DNA and proteins make a nucleosome?

[This object is a pull tab]

Answer 8

Slide 41 / 143 Transcription

Transcription of DNA into RNA occurs in the nucleus of the eukaryotic cell. Eukaryotic RNA polymerase needs the assistance of proteins called transcription factors to help regulate when a gene is expressed. If all the necessary transcription factors are present for a specific gene, then the gene can be expressed. If any are missing, transcription will not start. There can be thousands of transcription factors in an organism's cells (3,000 in humans). The kind and number of them present in the nucleus at any given time dictate what genes are expressed.

Slide 42 / 143 Transcription Factors

Transcription factors are proteins that are capable of binding with DNA. When they bind to areas near the promoter region of the gene they work with RNA polymerase to begin the transcription of that gene. They are produced in response to cues from the external environment of the cell. These proteins make the cell capable of turning on genes in response to external stimulus. This is essential to multicellular eukaryotes because it allows the different cells of the organism to communicate and respond to situations in unison.

Video on regulated transcription

slide-10
SLIDE 10

Slide 43 / 143

External Signals

Receptor

Metabolic pathway that produces a specific transcription factor in response to

  • signal. The product

enters the nucleus. Nucleus External signal activates membrane bound protein (receptor)

Signal Transcription Factor

Cell

Slide 44 / 143

13 The first step in eukaryotic gene expression is... A transcription B translation C RNA processing D unraveling the gene

Slide 44 (Answer) / 143

13 The first step in eukaryotic gene expression is... A transcription B translation C RNA processing D unraveling the gene

[This object is a pull tab]

Answer D

Slide 45 / 143

14 Where does transcription occur in eukaryotic cells? A nucleus B nucleiod C cytoplasm D cell membrane

Slide 45 (Answer) / 143

14 Where does transcription occur in eukaryotic cells? A nucleus B nucleiod C cytoplasm D cell membrane

[This object is a pull tab]

Answer A

Slide 46 / 143

15 Once the DNA is unwound from the chromatin, which of the following is necessary to begin transcription? A RNA polymerase B ribosome C transcription factors D both A & C

slide-11
SLIDE 11

Slide 46 (Answer) / 143

15 Once the DNA is unwound from the chromatin, which of the following is necessary to begin transcription? A RNA polymerase B ribosome C transcription factors D both A & C

[This object is a pull tab]

Answer D

Slide 47 / 143

16 Transcribe the following eukaryotic gene sequence: AACTGATTATGGGCT A AACTGATTATGGGCT B TTCACTAATACCCGA C UUGACUAAUACCCGA D UUCUGAUUAUGGGCU

Slide 47 (Answer) / 143

16 Transcribe the following eukaryotic gene sequence: AACTGATTATGGGCT A AACTGATTATGGGCT B TTCACTAATACCCGA C UUGACUAAUACCCGA D UUCUGAUUAUGGGCU

[This object is a pull tab]

Answer C

Slide 48 / 143 mRNA Processing

After Transcription, the transcript is known as pre-mRNA. Enzymes in the nucleus modify pre-mRNA before the genetic messages are sent to the cytoplasm. This is know mRNA processing . During mRNA processing, both ends of the pre-mRNA are altered. Some interior sequences of pre-mRNA may be cut out, and other parts spliced together.

Slide 49 / 143 Alteration of mRNA Ends

The 5`end of the pre-mRNA receives a molecule known as a nucleotide (or 5') cap. This cap is a modified guanine molecule (the G in A, T, C, G)

AUGCCCUUAGCC GAUGCCCUUAGCC

pre-mRNA 5' cap added

Slide 50 / 143 Alteration of mRNA Ends

The 3` end of the pre-mRNA gets a poly-A tail. This tail is series

  • f adenosine (A) nucleotides.

A A A A A A A A A A A A

AUGCCCUUAGCC GAUGCCCUUAGCCAAAAAAAA

  • riginal pre-mRNA

3' tail added

slide-12
SLIDE 12

Slide 51 / 143 Alteration of mRNA Ends

The modifications to the ends of the pre-mRNA have several functions: · They facilitate the export of mRNA from the nucleus to the cytoplasm. · They protect mRNA from hydrolytic enzymes once it is in the cytoplasm. · They help ribosomes attach to the mRNA so they can be translated into a protein.

Slide 52 / 143

RNA Splicing

Most eukaryotic genes and their RNA transcripts have long noncoding stretches of nucleotides that lie between coding regions. These noncoding regions are called intervening sequences, or introns. The other regions called exons (because they are eventually expressed), are usually translated into amino acid sequences. RNA splicing removes introns and joins exons, creating an mRNA molecule with a continuous coding sequence.

Slide 53 / 143

17What are the coding segments of a stretch of eukaryotic DNA called? A introns B exons C codons D replicons

Slide 53 (Answer) / 143

17What are the coding segments of a stretch of eukaryotic DNA called? A introns B exons C codons D replicons

[This object is a pull tab]

Answer B

Slide 54 / 143 mRNA Processing

This is an example of a pre-mRNA becoming a final transcript.

Slide 55 / 143

Some genes can code more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing. Alternative splicing allows the number of different proteins an organism can produce to be much greater than its number of genes.

Alternative RNA Splicing

slide-13
SLIDE 13

Slide 56 / 143 Alternative RNA Splicing

DNA sequence AAATTTCCCGGGAAATTTCCCGGG Pre-mRNA

(Cap)-UUUAAAGGGCCCUUUAAAGGGCCC-(Tail)

Alternate splices

(Cap)-UUU AAA UUU AAA-(Tail) OR (Cap)-GGC CCG GGC-(Tail)

Resulting polypeptide (protein) Phe - Lys - Phe - Lys OR Gly - Pro - Gly Alternate splicing can dramatically change the length and/or the sequence of the polypeptide chain that will be made

Slide 57 / 143

18Which of the following helps to stabilize mRNA by inhibiting its degradation? A RNA polymerase B ribosomes C 5' cap D poly-A tail E both C and D

Slide 57 (Answer) / 143

18Which of the following helps to stabilize mRNA by inhibiting its degradation? A RNA polymerase B ribosomes C 5' cap D poly-A tail E both C and D

[This object is a pull tab]

Answer E

Slide 58 / 143

19A transcription unit that is 8,000 nucleotides long may use 1,200 nucleotides to make a protein consisting of 400 amino

  • acids. This is best explained by the fact that

A many noncoding nucleotides are present in mRNA. B there is redundancy and ambiguity in the genetic code. C many nucleotides are needed to code for each amino acid. D nucleotides break off and are lost during the transcription process.

Slide 58 (Answer) / 143

19A transcription unit that is 8,000 nucleotides long may use 1,200 nucleotides to make a protein consisting of 400 amino

  • acids. This is best explained by the fact that

A many noncoding nucleotides are present in mRNA. B there is redundancy and ambiguity in the genetic code. C many nucleotides are needed to code for each amino acid. D nucleotides break off and are lost during the transcription process.

[This object is a pull tab]

Answer A

Slide 59 / 143

20Once transcribed, eukaryotic pre-mRNA typically undergoes substantial alteration that includes A removal of introns. B fusion into circular forms known as plasmids. C linkage to histone molecules. D union with ribosomes. E fusion with other newly transcribed mRNA.

slide-14
SLIDE 14

Slide 59 (Answer) / 143

20Once transcribed, eukaryotic pre-mRNA typically undergoes substantial alteration that includes A removal of introns. B fusion into circular forms known as plasmids. C linkage to histone molecules. D union with ribosomes. E fusion with other newly transcribed mRNA.

[This object is a pull tab]

Answer A

Slide 60 / 143

21A mutation in which of the following parts of a gene is likely to be most damaging to a cell? A intron B exon C would be equally damaging.

Slide 60 (Answer) / 143

21A mutation in which of the following parts of a gene is likely to be most damaging to a cell? A intron B exon C would be equally damaging.

[This object is a pull tab]

Answer B

Slide 61 / 143

22Alternative RNA splicing A can allow the production of proteins of dramatically different sizes from a single mRNA. B can allow the production of proteins of dramatically different amino acid sequences from a single mRNA. C Both can happen

Slide 61 (Answer) / 143

22Alternative RNA splicing A can allow the production of proteins of dramatically different sizes from a single mRNA. B can allow the production of proteins of dramatically different amino acid sequences from a single mRNA. C Both can happen

[This object is a pull tab]

Answer C

Slide 62 / 143

After the finalized mRNA transcript is complete and correct, the pores in the nuclear envelope allow it to pass to the cytoplasm where it can be translated into proteins by ribosomes. The nuclear pore is a protein structure that controls the traffic flow

  • f the nucleus. Each

nuclear pore is made up

  • f hundreds of

individual proteins that insure only mRNAs with proper caps and tails can make it to the cytoplasm.

Entrance into the Cytoplasm

slide-15
SLIDE 15

Slide 63 / 143

Hydrolytic enzymes in the cytoplasm breakdown mRNA molecules. The length of time an mRNA suvives in the cytoplasm relates to how much protein is made from it. Longer time in the cytoplasm means more translation by ribosomes. The length of the poly-A tail is one of many factors that determines the time of survival in the cytoplasm. The longer the tail, the longer it's survival.

Degradation of mRNA Slide 64 / 143

23 What is the importance of nuclear pores? A They allow the nucleus to communicate with other parts of the cell.

B They allow DNA to leave the nucleus in order to direct protein synthesis.

C They allow RNA to leave the nucleus in order to be translated in the cytoplasm. D They allow single stranded DNA molecules to enter the nucleus and assemble into the double helix.

Slide 64 (Answer) / 143

23 What is the importance of nuclear pores? A They allow the nucleus to communicate with other parts of the cell.

B They allow DNA to leave the nucleus in order to direct protein synthesis.

C They allow RNA to leave the nucleus in order to be translated in the cytoplasm. D They allow single stranded DNA molecules to enter the nucleus and assemble into the double helix.

[This object is a pull tab]

Answer C

Slide 65 / 143 Summary of Gene Expression Regulation in Eukaryotes

· The gene must be unpacked from chromatin · The right transcription factors must be present Transcription occurs · Cap and tail must be added to the mRNA · Pre-mRNA must be edited (spliced) · Nuclear pores allow passage to the cytoplasm · mRNA comes into contact with a ribosome Translation occurs · Protein is used within the cell or exported to the environment

Slide 66 / 143

Endomembrane System

Return to Table of Contents

Slide 67 / 143 The Endomembrane System

Several organelles, some made up mainly of membranes, form a type of assembly line in the cell. They make a protein, then process and ship it to its final destination whether that be inside or

  • utside the cell. Organelles included in this system include the

nucleus, rough and smooth endoplasmic reticulum, golgi appartus, and lysosomes. Collectively, we refer to them as the endomembrane system. Note: The plasma membrane is also considered part of this system

slide-16
SLIDE 16

Slide 68 / 143 The Endomembrane System Slide 69 / 143 Endoplasmic Reticulum

When RNA leaves the nucleus, it enters the endoplasmic reticulum (ER). This organelle is a series of membrane-bound sacs and tubules. It is continuous with the outer membrane of the nuclear envelope (reticulum comes from the latin word for little net). There are two types of endoplasmic reticulum: rough and smooth.

Slide 70 / 143 Rough Endoplasmic Reticulum

Rough ER has ribosomes attached to its membrane (thus a rough appearance). These ribosomes synthesize proteins that will be used in the plasma membrane, secreted outside the cell or shipped to another organelle called a lysosome. As proteins are made by the ribosomes, they enter the lumen (opening) of the ER where they are folded and processed.

Slide 71 / 143 Ribosomes

Large subunit Small subunit

Recall that the ribosome is made of rRNA and proteins. This is where translation

  • ccurs.

Ribosomes consist of two subunits, a small and a

  • large. Each subunit consists
  • f proteins and rRNA. The

two subunits come together when proteins need to be made.

Slide 72 / 143 Ribosomes

Recall ribosomes make peptide bonds between amino acids in translation. The instructions for making ribosomes are in the DNA. From DNA, rRNA is made. Some of the rRNA is structural and other rRNA holds the code from the DNA to make the ribosomal proteins from mRNA.

DNA mRNA Protein

transcription translation

Slide 73 / 143

24 Where are ribosomal subunits made in the cell? A Cytoplasm

B Nucleus

C Nucleolus D On the Plasma membrane

slide-17
SLIDE 17

Slide 73 (Answer) / 143

24 Where are ribosomal subunits made in the cell? A Cytoplasm

B Nucleus

C Nucleolus D On the Plasma membrane

[This object is a pull tab]

Answer C

Slide 74 / 143

25 What do ribosomes consist of? A proteins and DNA B proteins and rRNA

C proteins only D DNA only

Slide 74 (Answer) / 143

25 What do ribosomes consist of? A proteins and DNA B proteins and rRNA

C proteins only D DNA only

[This object is a pull tab]

Answer B

Slide 75 / 143

26 List all the parts of the endomembrane system. A rough and smooth endoplasmic reticulum, golgi appartus, lysosomes B nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes C nucleus, rough and smooth endoplasmic reticulum, golgi appartus D nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes, plasma membrane

Slide 75 (Answer) / 143

26 List all the parts of the endomembrane system. A rough and smooth endoplasmic reticulum, golgi appartus, lysosomes B nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes C nucleus, rough and smooth endoplasmic reticulum, golgi appartus D nucleus, rough and smooth endoplasmic reticulum, golgi appartus, lysosomes, plasma membrane

[This object is a pull tab]

Answer D

Slide 76 / 143

27 Which of the following is involved in making proteins? A Smooth E.R. B Ribosomes

C DNA D Nuclear membrane

slide-18
SLIDE 18

Slide 76 (Answer) / 143

27 Which of the following is involved in making proteins? A Smooth E.R. B Ribosomes

C DNA D Nuclear membrane

[This object is a pull tab]

Answer B

Slide 77 / 143 Smooth Endoplasmic Reticulum

This type of ER is called Smooth because it lacks ribosomes on its surface. (it looks smooth compared to rough ER) There are a variety of functions of this organelle, which include: · making lipids. · processing certain drugs and poisons absorbed by the cell. · storing calcium ions (for example, in muscle cells). Note: The liver is an organ that detoxifies substances that are brought into the body. Therefore, liver cells have huge amounts of Smooth ER.

Slide 78 / 143 Protein Transport

Once the proteins are processed, short chains of sugars are sometimes linked to these proteins, which are then known as

  • glycoproteins. These glycoproteins serve as "zip codes" that will

tell the protein where it will go. When the molecule is ready to be exported out of the ER, it gets packaged into a transport vesicle. This vesicle is made of membranes from the ER itself. The transport vesicle travels to another organelle known as the Golgi apparatus.

Slide 79 / 143

28 The endomembrane system serves to A ship cell products to places in and out of the cell B assemble DNA

C give directions to other organelles D create pathways for organelles to travel

Slide 79 (Answer) / 143

28 The endomembrane system serves to A ship cell products to places in and out of the cell B assemble DNA

C give directions to other organelles D create pathways for organelles to travel

[This object is a pull tab]

Answer A

Slide 80 / 143

29 What determines if we classify endoplasmic reticulum as smooth or rough? A presence or absence of nuclear pores B presence or absence of genetic material

C presence or absence of ribosomes D presence of absence of DNA

slide-19
SLIDE 19

Slide 80 (Answer) / 143

29 What determines if we classify endoplasmic reticulum as smooth or rough? A presence or absence of nuclear pores B presence or absence of genetic material

C presence or absence of ribosomes D presence of absence of DNA

[This object is a pull tab]

Answer C

Slide 81 / 143

30 Where in the cell are lipids made? A Nucleus B Ribosomes

C Rough endoplasmic reticulum D Smooth endoplasmic reticulum

Slide 81 (Answer) / 143

30 Where in the cell are lipids made? A Nucleus B Ribosomes

C Rough endoplasmic reticulum D Smooth endoplasmic reticulum

[This object is a pull tab]

Answer D

Slide 82 / 143 Golgi Apparatus

The main function of this

  • rganelle is to finish, sort, and

ship cell products. It works like the postal department of the cell. Structurally, the golgi consists

  • f stacked flattened sacs (sort
  • f looks like a stack of pita

bread).

Slide 83 / 143

The Golgi is located near the cell membrane. The Golgi works closely with the ER of a cell. It receives and modifies substances manufactured by the ER. Once the substances are modified, they are shipped out to other areas of the cell. One key difference between the Golgi apparatus and endoplasmic reticulum is that the sacs comprising the Golgi are not interconnected.

Golgi Apparatus Slide 84 / 143

The Golgi receives transport vesicles that bud off from the ER and contain proteins. It takes the substances contained in these vesicles and modifies them chemically in order to mark them and sort them into different batches depending on their destination. The finished products are then packaged into new transport vesicles which will then move to lysosomes, or will be inserted into the plasma membrane or dumped out of the cell if the protein is a secretory protein.

The Golgi Apparatus & the ER

Video on Protein Trafficking through the Golgi

slide-20
SLIDE 20

Slide 85 / 143

31 A difference between the Golgi Apparatus and the ER is that A The ER takes the vesicles from the Golgi to transport B The sacs making the Golgi are not interconnected

C The Golgi has ribosomes, the ER does not D There is no difference, they are part of the same organelle

Slide 85 (Answer) / 143

31 A difference between the Golgi Apparatus and the ER is that A The ER takes the vesicles from the Golgi to transport B The sacs making the Golgi are not interconnected

C The Golgi has ribosomes, the ER does not D There is no difference, they are part of the same organelle

[This object is a pull tab]

Answer B

Slide 86 / 143

32 Which organelle receives and modifies substances from the endoplasmic reticulum? A Nucleus B Ribosomes

C Lysosomes D Golgi Bodies

Slide 86 (Answer) / 143

32 Which organelle receives and modifies substances from the endoplasmic reticulum? A Nucleus B Ribosomes

C Lysosomes D Golgi Bodies

[This object is a pull tab]

Answer D

Slide 87 / 143 Lysosomes

Some proteins from the Golgi Apparatus are transported to the

  • lysosomes. As the

name suggests, a lysosome is an

  • rganelle that

breaks down other substances.

(lyse: to cause destruction)

They consist of hydrolytic enzymes enclosed within a

  • membrane. Hydrolytic enzymes

break polymers into monomers through hydrolysis.

Slide 88 / 143 Lysosomes

Lysosomes may fuse with food-containing organelles called vacuoles and then the enzymes digest the food, releasing nutrients into the cell. Protists do this. Damaged or unneeded proteins may become enclosed within a membranous vesicle which then fuses with a lysosome. The organic molecules from the breakdown process are recycled and reused by the cell.

slide-21
SLIDE 21

Slide 89 / 143

A peroxisome is a specific type of lysosome that forms and breaks down hydrogen peroxide (H2O2) which is toxic to cells. In all cells, hydrogen peroxide forms constantly (from the combining of hydrogen and oxygen as bi-products of metabolism) and needs to be broken down quickly. Important note: Peroxisomes are not part of the endomembrane system.

Peroxisomes Slide 90 / 143

33 Which organelle contains hydrolytic enzymes that break down

  • ther substances?

A Endoplasmic Reticulum B Golgi Bodies C Lysosomes D Vacuoles

Slide 90 (Answer) / 143

33 Which organelle contains hydrolytic enzymes that break down

  • ther substances?

A Endoplasmic Reticulum B Golgi Bodies C Lysosomes D Vacuoles

[This object is a pull tab]

Answer C

Slide 91 / 143

34 Which is not a function of lysosomes? A aiding the cell in creating ribosomes B fusing with vacuoles to digest food

C breaking polymers into monomers D recycling worn out cell parts

Slide 91 (Answer) / 143

34 Which is not a function of lysosomes? A aiding the cell in creating ribosomes B fusing with vacuoles to digest food

C breaking polymers into monomers D recycling worn out cell parts

[This object is a pull tab]

Answer A

Slide 92 / 143

Remember the plasma membrane is a phospholipid bilayer with proteins and other molecules interspersed throughout.

Plasma Membrane

Some proteins from the Golgi Apparatus become embedded in the membrane. Others are transported through the membrane to the external environment.

slide-22
SLIDE 22

Slide 93 / 143 Plasma Membrane

· Selective Permeability · Protection · Structural support The 3 main functions of the plasma membrane:

Slide 94 / 143

Passive transport is the movement of substances from an area of high concentration to an area

  • f low concentration

without the requirement an energy input. Types include diffusion, osmosis, and facilitated diffusion.

Membrane Transport - Review

Active transport is the movement of substances from an area of low concentration to an area of high concentration and requires an input of energy.

Passive Transport Active Transport (REQUIRES ENERGY)

Slide 95 / 143

35 Which of the following statements about the role of phospholipids in forming membranes is correct? A they are completely insoluble in water B they form a single sheet in water

C they form a structure in which the hydrophobic portion faces outward D they form a selectively permeable structure

Slide 95 (Answer) / 143

35 Which of the following statements about the role of phospholipids in forming membranes is correct? A they are completely insoluble in water B they form a single sheet in water

C they form a structure in which the hydrophobic portion faces outward D they form a selectively permeable structure

[This object is a pull tab]

Answer D

Slide 96 / 143

36 Active transport moves molecules A with their concentration gradients without the use of energy B with their concentration gradients using energy

C against their concentration gradients without the use of energy D against their concentration gradients using energy

Slide 96 (Answer) / 143

36 Active transport moves molecules A with their concentration gradients without the use of energy B with their concentration gradients using energy

C against their concentration gradients without the use of energy D against their concentration gradients using energy

[This object is a pull tab]

Answer D

slide-23
SLIDE 23

Slide 97 / 143

37 Which of the following processes includes all others? A passive transport B facilitated diffusion

C diffusion of a solute across a membrane D

  • smosis

Slide 97 (Answer) / 143

37 Which of the following processes includes all others? A passive transport B facilitated diffusion

C diffusion of a solute across a membrane D

  • smosis

[This object is a pull tab]

Answer A

Slide 98 / 143

Many proteins created by the cell are too large to pass through the membrane, even using protein carrier

  • r integral proteins. How do these

macromolecules exit the cell? When the substance needs other ways of getting into or out of a cell, they will enter and exit by fusing with the cell membrane.

Large Molecules and the Plasma Membrane

There are several special functions of the membrane as larger substances enter and exit the cell.

Slide 99 / 143

To excrete a macromolecule from the cell, the vesicles that enclose the proteins fuse with the plasma membrane and the vesicles then

  • pen up and spill their

contents outside of the cell. This process is known as exocytosis. The vesicle will become part of the cell membrane.

Exocytosis

Exocytosis

This is how secretory proteins from the Golgi exit the cell. This is true for insulin in the pancreas.

Slide 100 / 143

Insulin is a protein hormone made by certain cells of the pancreas that enable cells to take glucose (sugar) in from the blood. Insulin is a secretory protein made in the rough ER. Specifically, it is secreted out of the pancreas cells into the blood stream.

Insulin - A Secretory Protein Slide 101 / 143

The opposite of exocytosis is endocytosis. In this process, the cell takes in macromolecules or other particles by forming vesicles or vacuoles from its plasma membrane.

Endocytosis

This is how many protists ingest food particles

slide-24
SLIDE 24

Slide 102 / 143 3 Types of Endocytosis Slide 103 / 143

Phagocytosis Is for taking in solid particles. ("phago" mean to eat) Pinocytosis Is for taking in liquids. However what the cell wants is not the liquid itself, but the substances that are dissolved in the liquid. ("pino" means to drink) Receptor-mediated endocytosis requires the help of a protein coat and receptor on the membrane to get through.

3 Types of Endocytosis Slide 104 / 143

38 The process by which a cell ingests large solid particles, therefore it is known as "cell eating". A Pinocytosis B Phagocytosis

C Exocytosis D Osmoregulation

Slide 104 (Answer) / 143

38 The process by which a cell ingests large solid particles, therefore it is known as "cell eating". A Pinocytosis B Phagocytosis

C Exocytosis D Osmoregulation

[This object is a pull tab]

Answer B

Slide 105 / 143

39 Protein coated vesicles move through the plasma membrane via this process: A Phagocytosis B Active Transport

C Receptor-Mediated Endocytosis D Pinocytosis

Slide 105 (Answer) / 143

39 Protein coated vesicles move through the plasma membrane via this process: A Phagocytosis B Active Transport

C Receptor-Mediated Endocytosis D Pinocytosis

[This object is a pull tab]

Answer C

slide-25
SLIDE 25

Slide 106 / 143

40 After a vesicle empties its contents outside a cell, the vesicle becomes part of: A the Golgi B the plasma membrane

C another vesicle D the extracellular fluid

Slide 106 (Answer) / 143

40 After a vesicle empties its contents outside a cell, the vesicle becomes part of: A the Golgi B the plasma membrane

C another vesicle D the extracellular fluid

[This object is a pull tab]

Answer B

Slide 107 / 143

Energy-Converting Organelles

Return to Table of Contents

Slide 108 / 143 Energy-Converting Organelles

Chloroplasts reside in plant cells and some protists and convert solar radiation into energy stored in the cell for later use. Mitochondria reside in all eukaryotic cells and convert chemical energy from glucose into ATP. Interestingly, both chloroplasts and mitochondria have their own DNA, separate from that found in the nucleus of the cell. They also have a double cell membrane.

Slide 109 / 143

eukaryotic chloroplast

Chloroplasts

These organelles convert solar energy to chemical energy through

  • photosynthesis. Chloroplasts are

partitioned into three major compartments by internal membranes: · Thylakoids · Stroma · Intermembrane space

Slide 110 / 143 Thylakoids

In prokaryotes, thylakoids are areas of highly folded membranes. In eukaryotes, they are stacked in the chloroplasts. The fluid

  • utside these stacks of thylakoids is called the stroma; this is where

the Calvin cycle takes place.

eukaryotic chloroplast

Remember that during photosynthesis it is on the thylakoid that the Light Dependent Reactions take place.

slide-26
SLIDE 26

Slide 111 / 143 Mitochondria

Mitochondria are sometimes referred to as the "powerhouses"

  • f the cell. They convert chemical

energy (glucose) into a more usable and regenerative form of chemical energy (ATP). The mitochondria is also partitioned like the chloroplast. They only have two compartments as opposed to three in the chloroplast. · Matrix · Intermembrane space

Slide 112 / 143

Remember cell respiration must take place near a membrane so that a proton gradient can be built in a "membrane space" that is separate from the rest of the cell. Thus, the membrane would separate the inner volume, with a deficit of protons, from the

  • utside, with an excess.

In prokaryotes, the "inter-membrane space" is between the cell membrane and the cell wall. In eukaryotes, that membrane is the inter-membrane space of the mitochondria in between the inner membrane and outer membrane.

Mitochondria and Respiration Slide 113 / 143

The mitochondria and chloroplast are different from other eukaryotic

  • rganelles because they have their own DNA, their own ribosomes,

and have a double cell membrane. In 1970, Lynn Margulis published the "Theory of Endosymbiosis" to explain these facts. The theory states that the mitochondria and chloroplast were once free-living prokaryotes that got taken up (or "eaten") by another prokaryote. The mitochondria was a bacteria that could make its own ATP. The chloroplast was a bacteria that could perform photosynthesis.

The Evolution of Eukaryotes

endo: within sym: together bio: life sis: condition endosymbiosis = living together, within

Slide 114 / 143

When they got taken up by another prokaryote, they dragged the

  • ne prokaryote's cell membrane around theirs, thus the double cell
  • membrane. This now allowed the "new" eukaryote to make its own

ATP or be able to do photosynthesis and make its own food. Thus the evolution of eukaryotes.

Note: The nucleus and flagella could also have the same possible roots although they are not as heavily supported with evidence as the mitochondria and chloroplast.

Endosymbiotic Theory Slide 115 / 143 Evidence for Symbiosis

Both mitochondria and chloroplasts have their own protein- synthesizing machinery, and it more closely resembles that of bacteria than that found in the cytoplasm of eukaryotes. Both mitochondrial and chloroplast genomes consist of a single circular molecule of DNA, just like in prokaryotes. Both mitochondria and chloroplasts can arise only from preexisting mitochondria and chloroplasts. They cannot be form in a cell that lacks them. Both mitochondria and chloroplasts have their own DNA and it resembles the DNA of bacteria not the DNA found in the nucleus

Slide 116 / 143

Since mitochondrial DNA is not in the cell nucleus, it is only passed along from mother to child; animals, including you, inherit your mitochondria from your mother only. This is because the egg from our mothers contained her

  • rganelles. (Dad's sperm only contains the chromosomes, none
  • f his organelles usually).

All of our organelles we inherited from our mothers. Mitochondrial DNA is a way to trace maternal heritage through a family or through a species. The "Mitochondrial Eve" is the first human female that gave rise to all humans. In theory, we can trace all humans back to her through our mitochondrial DNA.

The Mitochondrial Eve

slide-27
SLIDE 27

Slide 117 / 143

41 Which organelle converts food energy into chemical energy that the cell can use? A Nucleus B Chloroplast

C Mitochondrion D Golgi

Slide 117 (Answer) / 143

41 Which organelle converts food energy into chemical energy that the cell can use? A Nucleus B Chloroplast

C Mitochondrion D Golgi

[This object is a pull tab]

Answer C

Slide 118 / 143

42 Which organelle converts solar energy into chemical energy in plants and other photosynthetic organisms? A Nucleus B Chloroplast

C Mitochondrion D Golgi

Slide 118 (Answer) / 143

42 Which organelle converts solar energy into chemical energy in plants and other photosynthetic organisms? A Nucleus B Chloroplast

C Mitochondrion D Golgi

[This object is a pull tab]

Answer B

Slide 119 / 143

43 Which of the following is not true of mitochondria and chloroplasts? A They are present in all eukaryotic cells B They have their own DNA C They have their own ribosomes D They are surrounded by a double membrane

Slide 119 (Answer) / 143

43 Which of the following is not true of mitochondria and chloroplasts? A They are present in all eukaryotic cells B They have their own DNA C They have their own ribosomes D They are surrounded by a double membrane

[This object is a pull tab]

Answer A

slide-28
SLIDE 28

Slide 120 / 143

44 Which of the following does NOT provide evidence for the

endosymbiotic theory? A Mitochondria and chloroplasts both have their own DNA. B Mitochondria and chloroplasts both come from pre-existing mitochondria and chloroplasts. C The DNA of mitochondria and chloroplasts resembles the DNA found in nuclei. D The DNA of mitochondria and chloroplasts resembles that of bacteria.

Slide 120 (Answer) / 143

44 Which of the following does NOT provide evidence for the

endosymbiotic theory? A Mitochondria and chloroplasts both have their own DNA. B Mitochondria and chloroplasts both come from pre-existing mitochondria and chloroplasts. C The DNA of mitochondria and chloroplasts resembles the DNA found in nuclei. D The DNA of mitochondria and chloroplasts resembles that of bacteria.

[This object is a pull tab]

Answer C

Slide 121 / 143

Other Organelles and Cellular Structures

Return to Table of Contents

Slide 122 / 143 Vacuoles

Vacuoles are membranous sacs and they come in different shapes and sizes and have a variety of functions.

Central Vacuole

PLANT CELL PROTIST

Slide 123 / 143 Central Vacuoles

Central Vacuoles in plants store water. Absorbing water makes a plant cell more turgid, or having more pressure inside - leading to strength and rigidity. Central vacuoles that are full will take over most of the cytoplasm and literally push the organelles to the sides

  • f the cell. It can also store

vital chemicals, pigments and waste products.

Slide 124 / 143

Increased turgor pressure results from the central vacuole being full with water. It presses out on the cell membrane which then presses out on the cell wall.

Turgor Pressure

The plant cell will not explode or lose its shape like an animal cell would in a hypotonic environment. When the turgor pressure decreases the cell is limp and droopy. This is associated with wilted, limp lettuce, as well as droopy flowers.

slide-29
SLIDE 29

Slide 125 / 143 Contractile Vacuoles

Contractile vacuoles can be found in certain single-celled protists. These act as a pump to expel excess water from the cell. This is especially helpful to those organisms living in a freshwater environment to keep the cell from exploding.

Slide 126 / 143 Food Vacuoles

Food Vacuoles are mainly found in protists. The protist ingests food particles. The particles then fuse with a lysosome. The lysosome contains hydrolytic enzymes that break the food down.

Paramecium fed dyed food showing vacuoles.

Slide 127 / 143

45 An organelle found in plant cells that stores water as well as

  • ther important substances is called the ___________.

A Lysosome B Contractile Vacuole C Central Vacuole D Golgi bodies

Slide 127 (Answer) / 143

45 An organelle found in plant cells that stores water as well as

  • ther important substances is called the ___________.

A Lysosome B Contractile Vacuole C Central Vacuole D Golgi bodies

[This object is a pull tab]

Answer C

Slide 128 / 143

46 Food vacuoles are primarily found in which organisms? A Plants B Animals

C Protists D Bacteria

Slide 128 (Answer) / 143

46 Food vacuoles are primarily found in which organisms? A Plants B Animals

C Protists D Bacteria

[This object is a pull tab]

Answer C

slide-30
SLIDE 30

Slide 129 / 143 Cytoskeleton

Cytoskeleton is a network of fibers within the cytoplasm. Three types of fibers collectively make up the cytoskeleton: · Microfilaments · Intermediate filaments · Microtubules These fibers provide structural support and are also involved in various types of cell movement and motility.

Slide 130 / 143

47 Cells can be described as having a cytoskeleton of internal structures that contribute to the shape, organization, and movement of the cell. All of the following are part of the cytoskeleton except

A the nuclear envelope. B microtubules. C microfilaments. D intermediate filaments.

Slide 130 (Answer) / 143

47 Cells can be described as having a cytoskeleton of internal structures that contribute to the shape, organization, and movement of the cell. All of the following are part of the cytoskeleton except

A the nuclear envelope. B microtubules. C microfilaments. D intermediate filaments.

[This object is a pull tab]

Answer A

Slide 131 / 143

48 Which of the following is not a known function of the cytoskeleton?

A to maintain a critical limit on cell size B to provide mechanical support to the cell C to maintain the characteristic shape of the cell D to hold mitochondria and other organelles in place within the cytosol

Slide 131 (Answer) / 143

48 Which of the following is not a known function of the cytoskeleton?

A to maintain a critical limit on cell size B to provide mechanical support to the cell C to maintain the characteristic shape of the cell D to hold mitochondria and other organelles in place within the cytosol

[This object is a pull tab]

Answer A

Slide 132 / 143 Cell wall

The cell wall is an outer layer in addition to the plasma membrane, found in fungi, algae, and plant cells. The composition of the cell wall varies among species and even between cells in the same individual. All cell walls have carbohydrate fibers embedded in a stiff matrix of proteins and other carbohydrates. Plant cell walls are made of the polysaccharide

  • cellulose. Fungal cell walls are made of the

polysaccharide chitin.

slide-31
SLIDE 31

Slide 133 / 143 Extracellular Matrix

The cells of many multi-cellular animals are surround by a extracellular matrix (ECM). The ECM provides structural support to the cells in addition to providing various other functions such as anchorage, cellular healing, separating tissues from one another and regulating cellular communication. The ECM is primarily composed of an interlocking mesh of proteins and carbohydrates.

Slide 134 / 143 Cell Surfaces and Junctions

Cell surfaces protect, support, and join cells. Cells interact with their environments and each other via their surfaces. Cells need to pass water, nutrients, hormones, and many, many more substances to one another. Adjacent cells communicate and pass substances to one another through cell junctions. Animal and plant cells have different types of cell junctions. This is mainly because plants have cell walls and animal cells do not.

Slide 135 / 143

Plant cells are supported by rigid cell walls made largely of cellulose. They connect by plasmodesmata which are channels that allow them to share water, food, and chemical messages.

Plant Cell Junctions Slide 136 / 143

Tight junctions Adhering junctions Communicating (Gap) junctions

Animal Cell Junctions Slide 137 / 143

tight junction

Tight Junctions

Tight junctions can bind cells together into leakproof sheets Example: the cells of the lining of the stomach

  • r any epithelial

lining where leaking

  • f substances is not

good.

Slide 138 / 143 Adhering Junctions

Adhering junctions fasten cells together into strong sheets. They are somewhat leakproof. Example: actin is held together in muscle.

slide-32
SLIDE 32

Slide 139 / 143 Communicating (Gap) Junctions

Gap junctions allow substances to flow from cell to

  • cell. They are totally
  • leaky. They are the

equivalent of plasmadesmata in plants. Example: important in embryonic development. Nutrients like sugars, amino acids, ions, and other molecules pass through.

Slide 140 / 143

49 Which type of junction is found in plant cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction

Slide 140 (Answer) / 143

49 Which type of junction is found in plant cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction

[This object is a pull tab]

Answer B

Slide 141 / 143

50 Which type of junction allows for the exchange of materials between animal cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction

Slide 141 (Answer) / 143

50 Which type of junction allows for the exchange of materials between animal cells? A Gap junction B Plasmodesmata C Tight junction D Adhering junction

[This object is a pull tab]

Answer A

Slide 142 / 143 Plant vs. Animal Cell Organelles

Click here to review the similarities and difference between plant and animal cells

slide-33
SLIDE 33

Slide 143 / 143 Organelles in Animal and Plant Cells

cell wall chloroplasts central vacuole plasma membrane mitochondria

Only Animal Only Plant Both

rough ER smooth ER lysosomes golgi apparatus ribosomes nucleus