The Universal SSU rRNA Tree Probing early eukaryotic Wheelis et al. 1992 PNAS 89: 2930 evolution using phylogenetic methods The Archezoa Hypothesis - primitively The SSU Ribosomal RNA Tree for Eukaryotes amitochondriate eukaryotes Animals (Tom Cavalier-Smith 1983) Fungi Choanozoa Trichomonas Microsporidia Plants / green algae Ciliates + Apicomplexa Mitochondria? Stramenopiles Red algae Dictyostelium Entamoebae Euglenozoa Physarum Prokaryotic Percolozoa outgroup Trichomonas Archezoa Giardia Microsporidia Giardia Entamoeba ‘Tree’ courtesy of W. Ford Doolittle The Archezoa Hypothesis T. Cavalier-Smith (1983) • The Archezoa hypothesis would fall if: – Find mitochondrial genes on archezoan genomes – Find that archezoans branch among aerobic species with mitochondria – Find mitochondrion-derived organelles in archezoans 1
Mitochondrial HSP 70 is encoded by the host nucleus but is of endosymbiotic origin Targeting PEPTIDE BINDING Retention ATPase DOMAIN sequences DOMAIN sequences N C Cytosolic HSP70 mitochondrial HSP70 Endosymbiotic origin alpha-proteobacteria RER HSP70 other proteobacteria chloroplasts Gram +ve & Archaea cyanobacteria Chaperonin 60 Protein Maximum Likelihood Tree Mitochondrial genes in Archezoa (PROTML, Roger et al. 1998, PNAS 95: 229) Archezoa Proteins of mitochondrial origin* Giardia / Heat shock 70, Chaperonin 60 Spironucleus Note 100% Bootstrap support Trichomonas Heat shock 70, Chaperonin 60 Microsporidia Heat shock 70 Entamoeba Heat shock 70, chaperonin 60 A case of Eukaryote Eukaryote HGT? *defined as forming a monophyletic group with mitochondrial homologues in a non-controversial species phylogeny Long branches may cause problems for Chaperonin 60 Protein Maximum Likelihood Tree phylogenetic analysis (PROTML, Roger et al. 1998, PNAS 95: 229) • Felsenstein (1978) made a simple model phylogeny including four taxa and a mixture of short and long branches A A B p p D Longest q TRUE TREE WRONG TREE p > q branches q q C C D B • Methods which assume all sites change at the same rate (e.g. PROTML) may be particularly sensitive to this problem 2
Cpn-60 Protein ML tree (PROTML) from variable A simple experiment: sites with outgroups removed Giardia • Does the Cpn60 tree topology change: – If we remove long-branch outgroups Trichomonas – If we remove sites where every species 30 Euglena & Trypanosoma has the same amino acid 31 Animals & Fungi Apicomplexa Dictyostelium Plants Entamoeba The Archezoa Hypothesis T. Cavalier-Smith (1983) • The Archezoa hypothesis would fall if: – Find mitochondrial genes on archezoan genomes – Find that archezoans branch among aerobic species with mitochondria – Find mitochondrion-derived organelles in archezoans a -tubulin trees place Microsporidia with Fungi Microsporidia are primitive and early Edlind TD, et al. (1996). Mol Phylog Evol 5 :359-67 branching eukaryotes or relatives of fungi? Keeling PJ, Doolittle WF. (1996). Mol Biol Evol 13 :1297-305. • Microsporidia branch deep in some trees but not in others Microsporidia – Deep: SSU rRNA, EF-2 – With fungi: tubulin and HSP70 65 Fungi • Microsporidia contain a mitochondrial HSP70 – They once contained the mitochondrial endosymbiont and thus are not Archezoa sensu Cavalier-Smith – Hirt et al., 1997 – Or they obtained this gene (and the one for tubulin) from fungi via HGT Other eukaryotes – Sogin, 1997 Curr. Op. Genet. Dev. 7: 792-799 3
Maximum likelihood and phylogenetic inference • The maximum likelihood tree is the one with The tree shown is the maximum the highest probability of giving rise to the likelihood tree data under a particular model obtained using a 88 program called • It is not the probability that it is the “true” PROTML 83 75 tree Assumptions underpinning the LogDet/Paralinear distances for EF-2 DNA variable sites codon positions 1+2 PROTML model Animals • Assumes all sites in the molecule can change • Assumes that all sequences are evolving in Chlorella 70 Trypanosoma the same way Trichomonas • EF-2 violates both of these assumptions: 60 Giardia Dictyostelium Human CAGGAATCACCTACGATCCTCGGCGGCGTTACGAACCGAA 53%G+C 25 Entamoeba Saccharomyces CAGGAATCACTTACGATCTTAAGCGGCGTTACGAACAGAA 46%G+C Microsporidia Chlorella CAGGAATCACCTACGATCCTCAGCGGCGCTACGAACCGGC Saccharomyces Dictyostelium CAGGAAACACTTTCGATCTTGTTCGGAGTAATTCTGCGGC 76 + fungi! Trypanosoma CAGGAATCACTTTCGATCCTGAGCGGCGATATGAACCGGC Glugea Entamoeba CAGGAATCACTTACGATCCTAAGCGGAGTAACGAACAGCC Cryptosporidium Cryptosporidium CAGGAATCACTTACGATCCTGCGCGGCGTTACGAACCGGC Tritrichomonas CAGGAATCACCTACGATCCTAAGCGGCGTTACGAACCGCC 54%G+C Sulfolobus Tritrichomonas CAGGAATCACCTACGATCCTAAGCGGCGTTACGAACCGCC 54%G+C Archaebacteria Giardia CAGGAATCACCTACGATCCTTCGCGGCGTTACGAACCGCA 53%G+C Methanococcus Glugea CAGGAAAGACCTACGATGCTGATCGGAGTAATGAACCGGA 45%G+C outgroups Halobacterium Sulfolobus CAGGAAACACACAGGAACCTGTGCGGCTGCTTGATACTTC 43%G+C Methanococcus CAGGAAACACTTTCGAAATTTTGCGGCTGCCTGATTGAGA 44%G+C Halobacterium CAGGAAACACCTACGAAACTACGCGGCTGCATGAACGAGA 58%G+C A combination of factors (outgroup GC content & site A combination of factors (outgroup GC content and rate heterogeneity) influence the EF-2 DNA tree site rate heterogeneity) influence the EF-2 DNA tree Methanococcus outgroup Halobacterium outgroup Methanococcus outgroup Halobacterium outgroup (low G+C) Higher G+C (low G+C) Higher G+C 100 100 100 100 80 80 Bootstrap 80 80 60 60 values LogDet ML Bootstrap 60 60 estimate 40 40 values 40 40 20 20 20 20 0 0 0 20 40 60 80 100 0 20 40 60 80 100 0 0 0 20 40 60 80 100 0 20 40 60 80 100 Fraction of constant sites removed Fraction of constant sites removed (Microsporidia, outgroup) (Microsporidia, outgroup) (Microsporidia, Fungi) 4
Are the former Archezoa really A combination of factors (outgroup GC content & site rate heterogeneity) influence the EF-2 DNA tree ancient offshoots? Methanococcus outgroup Halobacterium outgroup • Probably not: (low G+C) Higher G+C • Microsporidia are related to fungi (Tubulin, RNA 100 100 polymerase,LSU rRNA, HSP70, TATA binding protein, 80 80 EF-2, EF-1 alpha, SSU rRNA) Bootstrap 60 60 • Evidence for Giardia and Trichomonas branching deeper values than other eukaryotes is based on trees made using 40 40 unrealistic assumptions (often PROTML) 20 20 • There is plenty of room for new hypotheses 0 0 0 20 40 60 80 100 0 20 40 60 80 100 Fraction of constant sites removed (Giardia, Trichomonas, outgroup) Microsporidia are obligate If former archezoa contain intracellular parasites genes from the mitochondrial endosymbiont what happened to the organelle? Life cycle of microsporidia mtHsp70 has diverse roles in mitochondria Pfanner and Geissler 2001 Nature Reviews 2: 339-344 Tree of Mitochondrial Hsp70 mtHsp70 mtHsp70 also plays a role in assembly of Fe-S clusters - an essential function for yeast mitochondria (Lill & Kispal, 2000) 5
Localisation of a mtHsp70 in Trachipleistophora Microsporidial HSP70 have no obvious N-terminal targeting signal Confocal microscopy using an antibody to Th-mtHsp70 Infected Rabbit Spores cells Western blot using an antibody to Th-mtHsp70 The Hsp70 protein is Microsporidian localised to membrane bound or electron dense structures. Microsporidian ‘mitochondrial remnant’ Host cell mitochondrion Traditional fixation methods show a double membrane Williams et al. 2002 Nature 418: 865-869 Phylogenetic analysis requires Trees are a good way of exploring the careful thought history of genes but care is needed! • Making trees is not easy: • Phylogenetic analysis is frequently treated as a black box into which data are fed (often gathered – Among-site rate heterogeneity, “fast clock” species, shared nucleotide or amino at considerable cost) and out of which “The Tree” springs acid composition biases – Different data sets may be affected by • (Hillis, Moritz & Mable 1996, Molecular Systematics) individual phenomena to different degrees – Biases need not be large if phylogenetic signal is weak 6
Recommend
More recommend
