Eukaryotes & Gene used for any commercial purpose without the - - PDF document

▶
eukaryotes gene
SMART_READER_LITE
LIVE PREVIEW

Eukaryotes & Gene used for any commercial purpose without the - - PDF document

Slide 1 / 81 Slide 2 / 81 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and teachers. These materials


slide-1
SLIDE 1

Slide 1 / 81

This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and teachers. These materials may not be used for any commercial purpose without the written permission of the owners. NJCTL maintains its website for the convenience of teachers who wish to make their work available to other teachers, participate in a virtual professional learning community, and/or provide access to course materials to parents, students and others.

Click to go to website: www.njctl.org New Jersey Center for Teaching and Learning Progressive Science Initiative

Slide 2 / 81

www.njctl.org

Eukaryotes & Gene Expression Practice Questions

Slide 3 / 81

1 Identify two characteristics that are shared by all cells.

Slide 4 / 81

2 Suppose you are investigating a cell that contains a nucleus. Would you categorize this cell as a prokaryote or eukaryote? Explain your answer.

Slide 5 / 81

3 Is it more efficient for cells to have a high or low surface area to volume ratio? Explain.

Slide 6 / 81

4 Explain, in terms of cell function, why it is more advantageous for cells to be small.

slide-2
SLIDE 2

Slide 7 / 81

5 Organelles are to cells as organs are to the human body. Explain why this analogy is true.

Slide 8 / 81

6 What are two differences between prokaryotic and eukaryotic cells?

Slide 9 / 81

7 Would you be more likely to observe a prokaryotic cell or eukaryotic cell under the lowest magnification available on your microscope? Explain your answer.

Slide 10 / 81

8 Explain, in terms of surface area to volume ratio, why cells are small.

Slide 11 / 81

9 Identify the four major categories of eukaryotic cells.

Slide 12 / 81

10 Explain how the meaning of the terms prokaryote and eukaryote help explain the structure of the cell.

slide-3
SLIDE 3

Slide 13 / 81

11 Why is it important that the nucleus of a cell contains nuclear pores?

Slide 14 / 81

12 How is it possible that even though all the cells of a multicellular organism contain the same DNA, there are many different types of cells that differ in structure and function?

Slide 15 / 81

13 How are chromosomes related to chromatin?

Slide 16 / 81

14 How does the ‘packing’ of DNA impact the process of gene expression in cells?

Slide 17 / 81

15 How does the presence of transcription factors influence the process of gene expression?

Slide 18 / 81

16 How is the presence of transcription factors related to external stimuli in an environment?

slide-4
SLIDE 4

Slide 19 / 81

17 Explain the observable differences that would exist between a molecule of pre-mRNA and a finished molecule of mRNA?

Slide 20 / 81

18 In what way does the splicing of a molecule of mRNA alter the contents of the molecule? Be sure to use appropriate terminology.

Slide 21 / 81

19 How does alternative splicing affect the ability of a molecule of mRNA to produce multiple proteins?

Slide 22 / 81

20 Explain how nuclear pores are like the ‘gatekeepers’ of the nuclear membrane.

Slide 23 / 81

21 How does the length of a poly-A tail on mRNA impact the amount of protein can be produced from the mRNA?

Slide 24 / 81

22 Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps

  • f RNA processing. (Exons are bold)

Non-template strand:

5’ATTATGGGCATATATCCG GCGCCTTAATTATTC3’

Template strand:

3’TAATACCCGTA TATAGGC CGCGGAATTAA TAAG5’

slide-5
SLIDE 5

Slide 25 / 81

23 How is the process of transcription related to the process of translation in the cell?

Slide 26 / 81

24 Why is the nucleus often referred to as the ‘control center’ of the cell.

Slide 27 / 81

25 Is the process of gene expression the same in prokaryotes as it is in eukaryotes? Explain your answer.

Slide 28 / 81

26 What is the difference between prokaryotic and eukaryotic DNA?

Slide 29 / 81

27 What role do histones play in the packing of DNA?

Slide 30 / 81

28 How is the presence of transcription factors related to the characteristics that define living

  • rganisms?
slide-6
SLIDE 6

Slide 31 / 81

29 Identify the purpose of the modification of pre- mRNA by adding the nucleotide cap and poly-A tail.

Slide 32 / 81

30 Why are coding segments of mRNA referred to as ‘exons?’

Slide 33 / 81

31 Explain how alternative splicing allows a cell to produce different proteins from the same segment

  • f mRNA.

Slide 34 / 81

32 Given the sequence of eukaryotic DNA below, transcribe the gene and complete all three steps

  • f RNA processing. (Exons are bold)

Non-template strand:

3’GGCCGGCTATAATCGATACTTACGAATGTAAAA5’

Template strand:

5’CCGGCCGATATTAGCTATGAATGCTTACATTTT3’

Slide 35 / 81

33 What role do hydrolytic enzymes play in the production of protein in a cell?

Slide 36 / 81

34 What are the components of the ‘endomembrane system?’

slide-7
SLIDE 7

Slide 37 / 81

35 How does the role of the smooth endoplasmic reticulum relate to the amount of smooth E.R. found within different types of cells?

Slide 38 / 81

36 Explain the progression of a protein through the endomembrane system of a cell.

Slide 39 / 81

37 Compare the Golgi apparatus to a component of a city or town, based on the function of the

  • rganelle.

Slide 40 / 81

38 How is the creation of lysosomes related to the Golgi apparatus?

Slide 41 / 81

39 How is a peroxisome related to a lysosome?

Slide 42 / 81

40 Why are cell membranes often referred to as semipermeable?

slide-8
SLIDE 8

Slide 43 / 81

41 Identify and explain the process by which large proteins created in the cell are transported to the extracellular environment?

Slide 44 / 81

42 What is a ‘secretory protein?’

Slide 45 / 81

43 Identify the relationship between ribosomes and the rough endoplasmic reticulum.

Slide 46 / 81

44 How does a glycoprotein help determine the role

  • f a protein within a cell?

Slide 47 / 81

45 What is the function of the Golgi apparatus in the process of protein production within a cell?

Slide 48 / 81

46 Identify three different cellular functions accomplished by the smooth E.R.

slide-9
SLIDE 9

Slide 49 / 81

47 What is the purpose of lysosomes for the cell?

Slide 50 / 81

48 What function do peroxisomes perform for the cell?

Slide 51 / 81

49 What role might a protein play that is created within the cell and becomes embedded in the cell membrane?

Slide 52 / 81

50 Why is endocytosis important for efficient cellular function?

Slide 53 / 81

51 Explain the structure of a chloroplast, identifying the areas where the light reactions and Calvin cycle occur.

Slide 54 / 81

52 What is the function of the mitochondria for the cell?

slide-10
SLIDE 10

Slide 55 / 81

53 Do prokaryotic cells contain mitochondria? Explain your answer.

Slide 56 / 81

54 Both mitochondria and chloroplasts contain highly folded internal membranes. Explain the importance of these membranes for the organelle, including the importance of the folded nature.

Slide 57 / 81

55 Briefly summarize the endosymbiotic theory as proposed by Lynn Margulis.

Slide 58 / 81

56 According to the endosymbiotic theory, before they were eukaryotic organelles, the chloroplast and mitochondria more closely resembled what type of organism?

Slide 59 / 81

57 Why is mitochondrial DNA utilized to trace maternal heritage?

Slide 60 / 81

58 Identify the role of the chloroplast for a plant cell.

slide-11
SLIDE 11

Slide 61 / 81

59 Do plant cells contain mitochondria even though they are photosynthetic? Explain your answer.

Slide 62 / 81

60 Explain the meaning of the term endosymbiosis.

Slide 63 / 81

61 What is the evidence used to support the endosymbiotic theory?

Slide 64 / 81

62 What is the ‘mitochondrial eve?’

Slide 65 / 81

63 Why do organisms receive all of their mitochondrial DNA from their mother?

Slide 66 / 81

64 How is the central vacuole of a plant cell related to wilting?

slide-12
SLIDE 12

Slide 67 / 81

65 How do a food vacuole and lysosome help to digest particles within a cell?

Slide 68 / 81

66 What is the role of a contractile vacuole in a cell?

Slide 69 / 81

67 How are sugars related to the cell wall of plant cells?

Slide 70 / 81

68 Why is it important that adjacent plant and animal cells contain cell junctions?

Slide 71 / 81

69 Suppose you are investigating a cell that contains

  • plasmodesmata. Would you label this cell as a

plant or animal cell? Explain your answer.

Slide 72 / 81

70 Which sort of cell junction would you most likely

  • bserve between adjacent cells that cannot

experience leakage? What type of cells may you be observing?

slide-13
SLIDE 13

Slide 73 / 81

71 If animal cells need to transport ions and sugars, what sort of cell junction would you predict they would utilize? Support your response.

Slide 74 / 81

72 What is a vacuole?

Slide 75 / 81

73 How is a central vacuole related to turgor pressure in a cell?

Slide 76 / 81

74 What is a cytoskeleton and what does it do for the cell?

Slide 77 / 81

75 Compare and contrast the external structure of plant cells and fungi.

Slide 78 / 81

76 What role does the extracellular matrix provide for a group of cells?

slide-14
SLIDE 14

Slide 79 / 81

77 Do plant and animal cells contain the same type

  • f cell junctions? Why or why not?

Slide 80 / 81

78 Finish the following analogy. Plasmodesmata: plant cells:: __________________: animal cells.

Slide 81 / 81

79 Identify three differences between the structure of plant and animal cells.