pneumo or hemothorax an ebm primer for diagnostic and
play

Pneumo or Hemothorax: An EBM Primer for Diagnostic and Treatment - PowerPoint PPT Presentation

Feb 11, 2023 •161 likes •649 views

Pneumo or Hemothorax: An EBM Primer for Diagnostic and Treatment Dr Marcel mond MSc CCFP(EM) FRCP(C) CHU de Qubec Enfant-Jsus Associate professor, Universit Laval Research director, CETIe Conflict of interest No COI Road

  1. Pneumo or Hemothorax: An EBM Primer for Diagnostic and Treatment Dr Marcel Émond MSc CCFP(EM) FRCP(C) CHU de Québec – Enfant-Jésus Associate professor, Université Laval Research director, CETIe

  2. Conflict of interest • No COI

  3. Road Traffic injuries - 2016 • Lethal : 351 • BIBA: 1476 • Minor: 35 826 • Population: 8.2 millions

  4. Quebec City - Level 1 trauma center QuickTime™ et un QuickTime™ et un décompresseur sont requis pour visionner cette image. décompresseur sont requis pour visionner cette image.

  5. Objectives • To examine recent evidence on the detec- tion and treatment of pneumothorax, hemothorax, delayed hemothorax in the emergency department. • To compare the diagnostic modalities available and evaluate the need to drain a small, occult, or large pneumothorax or hemothorax.

  7. Plan • Diagnostic phase • Treatment plan

  9. Injury Mechanisms Demographics • N= 16,773 • Mean age (SD): 47.8 (19.9) Car • Male : 76.2% Motorbike Bicycle • Mean ISS (SD) : 20.7 (7.5) Pedestrian • Mortality : 4.8 % High-fall Low-fall

  12. Plan • Diagnostic phase • Treatment plan

  13. Diagnostic phase • Plain x-rays • Ultrasound • Delayed hemothorax

  14. Oblique Chest x-rays!

  15. 95% CI 95 % CI PPV = 95.6 (0.86 to 0.99 ) PPV = 93.6 ( 0.84 to 0.98) (0.87 to 0.91) (0.89 to 0.91) NPV = 90.1 NPV = 90.4 Sensitivity = 61.4 (0.56 to 0.64) Sensitivity = 62.9 (0.57 to 0.66) Specificity = 99.2 (90.98 to 1.00) Specificity = 98.8 (0.97 to 1.00)

  18. Ultrasound

  19. Ultrasound

  20. Ultrasound

  23. Ultrasound – Hemothorax Systematic Review

  24. Prehospital ultrasound

  25. Delayed Hemothorax • Misthos (2004) : incidence of 7.4 % in the 14 days after a thoracic injury • Longest delayed hemothorax was at nearly 45 days. • Possible mortality and morbidity

  26. Delayed hemothorax

  27. Delayed hemothorax

  28. Delayed hemothorax

  29. Plan • Diagnostic phase • Treatment plan

  30. Treatment modalities • Wait and see! • Drain it!

  31. Occult pneumotorax: please do not touch?

  32. Occult pneumotorax: please do not touch?

  33. Occult pneumotorax: please do not touch?

  34. Occult pneumotorax: please do not touch?

  35. Occult pneumotorax: please do not touch?

  36. Occult pneumotorax: please do not touch? • 277/602 (46%) of patients managed conservatively • 252/277 (90%) did not require subsequent thoracic intervention • Positive pressure ventilation = no influence • Less than 2 cm!

  37. Occult pneumotorax: please do not touch?

  38. Needle decompression – size and location matter?! • ATLS: decompression using a 5-cm angiocatheter at the second intercostal space (ICS2) on the midclavicular line (MCL) • Failure rate – 13-40%

  39. Needle decompression – size and location matter?!

  40. Needle decompression – size and location matter?! 5 cm catheter at ICS 5 - AAL 8 cm catheter at ICS 2 – MCL

  41. Needle decompression – size and location matter?!

  42. What size/type of tube for hemothorax?

  44. What size/type of tube for hemothorax?

  45. What size/type of tube for hemothorax?

  46. What size/type of tube for hemothorax?

  47. Take home messages! • Diagnostic phase – Oblique Chest-Xray could be useful – Ultrasound at the bedside – Delayed hemothorax can be predicted • Treatment plan – Small pneunothorax : conservative? – Needle decompression: use a bigger or change location – Hemothorax : smaller drain?

  48. Thank you! • www.cetie.info • E-mail: marcel.emond@fmed.ulaval.ca • Twitter: @marcel_mond

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Finding Pneumo HKUST iGEM 2014 TEAM In Intr troduc oduction tion Human n Introduc oducti

Finding Pneumo HKUST iGEM 2014 TEAM In Intr troduc oduction tion Human n Introduc oducti

Finding Pneumo HKUST iGEM 2014 TEAM In Intr troduc oduction tion Human n Introduc oducti tion on 2 Conclusi clusion on Pneumo mose senso nsor Riboregul ulator tor Pract ctice ce Bac ackgr ground ound an and d Mo

734 views • 37 slides
Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer

Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer

Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer Gene Name Aaed1 CGAAGCCTATAGGTGGCATT CCTAGCTTTCTGCCAAGGAG Aarsd1 GCCTCCCTTAGAGGCTTTTC CTGTGGCCCTTACCTGAATG Abcg3 CAGAGTGGGGTGACAGTTCC

91 views • 5 slides
Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for

Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for

Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for Journalists General Categories Command and Control Liability Disclosure Ecosystem and Place-based Programs Marketable Permits,

426 views • 14 slides
STUDENT PRIMER FOR PRESENTING ON THE STROKE SERVICE Justin A. Sattin, MD June, 2013 Overview of

STUDENT PRIMER FOR PRESENTING ON THE STROKE SERVICE Justin A. Sattin, MD June, 2013 Overview of

Department of Neurology STUDENT PRIMER FOR PRESENTING ON THE STROKE SERVICE Justin A. Sattin, MD June, 2013 Overview of Neurological Diagnosis The neurological diagnostic method, like that of all medical fields, has two aspects: the anatomical

399 views • 14 slides
PARCC Diagnostic Assessments for Mathematics Comprehension: A Diagnostic Classification Model

PARCC Diagnostic Assessments for Mathematics Comprehension: A Diagnostic Classification Model

PARCC Diagnostic Assessments for Mathematics Comprehension: A Diagnostic Classification Model Approach Laine P. Bradshaw The University of Georgia June 24, 2015 Overview A brief introduction to diagnostic classification models (DCMs)

305 views • 27 slides
Diagnostic studies Diagnostic studies (histopathology & PCR) (histopathology & PCR)

Diagnostic studies Diagnostic studies (histopathology & PCR) (histopathology & PCR)

FAO/MARD Joint Final Technical and National Consultations on Acute Hepatopancreatic Necrosis Syndrome (AHPNS) of Cultured Shrimp (TCP/VIE/3304) Diagnostic studies Diagnostic studies (histopathology & PCR) (histopathology & PCR)

369 views • 25 slides
Overview Diagnostic Criteria Current: Diagnostic & Statistical Manual-IV (DSM-IV)

Overview Diagnostic Criteria Current: Diagnostic & Statistical Manual-IV (DSM-IV)

6/26/2013 The Nuts and Bolts of Diagnosing Autism Spectrum Disorders In Young Children Jessica Greenson, Ph.D. Autism Center University of Washington Overview Diagnostic Criteria Current: Diagnostic & Statistical Manual-IV

424 views • 21 slides
Diagnostic Error Human Expertise and Cognitive Biases Diagnostic Error A recent article by

Diagnostic Error Human Expertise and Cognitive Biases Diagnostic Error A recent article by

6/6/2019 Diagnostic Error Human Expertise and Cognitive Biases Diagnostic Error A recent article by Abraham Verghese looked a self-reported diagnostic error Verghese et al A. J. Med. December 2015: 128:1322-1324 Inadequate physical exam

259 views • 12 slides
My Kitchen Table PCR Sophomore Year of High School PCR Primer Primer-Defined Changes to the PCR

My Kitchen Table PCR Sophomore Year of High School PCR Primer Primer-Defined Changes to the PCR

My Kitchen Table PCR Sophomore Year of High School PCR Primer Primer-Defined Changes to the PCR Copies + Copying DNA with Polymerase Chain Reaction Creating the Chromophore Colorwheel Chromophore ConservedSimilarDivergent Acropora

692 views • 43 slides
Impact Fee Primer Impact Fee Primer James B. Duncan, FAICP President Duncan Associates

Impact Fee Primer Impact Fee Primer James B. Duncan, FAICP President Duncan Associates

Impact Fee Primer Impact Fee Primer James B. Duncan, FAICP President Duncan Associates Austin, TX Arthur C. Nelson, Ph.D., FAICP Presidential Professor University of Utah, Salt Lake City, UT Carson Bise, AICP President

320 views • 6 slides
Introducing the Diagnostic Assessment Program Electronic Pathway Solution (DAP-EPS):

Introducing the Diagnostic Assessment Program Electronic Pathway Solution (DAP-EPS):

Introducing the Diagnostic Assessment Program Electronic Pathway Solution (DAP-EPS): Empowering patients through their diagnostic journey Melissa Kaan, BSc, MRT (NM), MBA Manager, Diagnostic Assessment Program, Cancer Care Ontario UICC

137 views • 11 slides
Primer for First-Time Attendees Mary Stuart Hunter Associate Vice President & Executive

Primer for First-Time Attendees Mary Stuart Hunter Associate Vice President & Executive

Primer for First-Time Attendees Mary Stuart Hunter Associate Vice President & Executive Director Jennifer R. Keup Director John N. Gardner Founder & Senior Fellow Definitions of Primer Primer any book of elementary

548 views • 23 slides
A Primer on Sets, Classes Set (or Class ) We take the notion of A is a set or A is a

A Primer on Sets, Classes Set (or Class ) We take the notion of A is a set or A is a

(LMCS) Primer.1 A Primer on Sets, Classes Set (or Class ) We take the notion of A is a set or A is a class as understoodno definition is given. Intuitively a set is any collection of thingsthe things in the set are called

397 views • 14 slides
On- -line diagnostic of a PEM fuel cell stack line diagnostic of a PEM fuel cell stack On based

On- -line diagnostic of a PEM fuel cell stack line diagnostic of a PEM fuel cell stack On based

International Symposium on Diagnostic Tools for Fuel Cell Technologies Trondheim, June 24th, 2009 On- -line diagnostic of a PEM fuel cell stack line diagnostic of a PEM fuel cell stack On based on the electrical power converter based on the

477 views • 20 slides
Manufacturing Diagnostic Tool Manufacturing Diagnostic Tool An on board on board low cost

Manufacturing Diagnostic Tool Manufacturing Diagnostic Tool An on board on board low cost

EBTW05 EBTW05 Manufacturing Diagnostic Tool Manufacturing Diagnostic Tool An on board on board low cost diagnostic test solution low cost diagnostic test solution An EBTW 2005, Tallinn, Estonia Slide 1 EBTW05 EBTW05 Agenda Challenges

503 views • 24 slides
Linac Simulation Linac Simulation Primer Primer J.-F. Ostiguy APC ostiguy@fnal.gov September

Linac Simulation Linac Simulation Primer Primer J.-F. Ostiguy APC ostiguy@fnal.gov September

Linac Simulation Linac Simulation Primer Primer J.-F. Ostiguy APC ostiguy@fnal.gov September 2013 Ostiguy Linac Simulation Primer - Sep 2013 Introduction This talk is not a summary of recent linac simulation work it is meant

642 views • 36 slides
CS 644: Introduction to Big Data Chapter 1. Introduction Chase Wu Professor of Computer Science

CS 644: Introduction to Big Data Chapter 1. Introduction Chase Wu Professor of Computer Science

CS 644: Introduction to Big Data Chapter 1. Introduction Chase Wu Professor of Computer Science Collaborative Research Staff Director of Center for Big Data Computer Science and Mathematics Division New Jersey Institute of Technology Oak

480 views • 17 slides
LOCK OUT TAG OUT Aegean Oil Terminal Corporation 1 Training Program LOTO is necessary for the

LOCK OUT TAG OUT Aegean Oil Terminal Corporation 1 Training Program LOTO is necessary for the

A EGEA N LOCK OUT TAG OUT Aegean Oil Terminal Corporation 1 Training Program LOTO is necessary for the protection of personal from the unexpected energization / startup of machinery and equipment or the release of hazardous energy during

540 views • 32 slides
Biomagnetic and Neuromagnetic Approaches to the Study of Epilepsy Shoogo Ueno Professor

Biomagnetic and Neuromagnetic Approaches to the Study of Epilepsy Shoogo Ueno Professor

CADET 2009, March 28 th -30 th , 2009, Kitakyushu, Japan Biomagnetic and Neuromagnetic Approaches to the Study of Epilepsy Shoogo Ueno Professor Emeritus, University of Tokyo Professor, Graduate School of Engineering, Kyushu University 1

1.16k views • 80 slides
TRAUMATIC BRAIN INJURY SEIZURE PROPHYLAXIS MAJOR SEAN MEREDITH BSCH, BSP, PHARM D, CD ROYAL

TRAUMATIC BRAIN INJURY SEIZURE PROPHYLAXIS MAJOR SEAN MEREDITH BSCH, BSP, PHARM D, CD ROYAL

TRAUMATIC BRAIN INJURY SEIZURE PROPHYLAXIS MAJOR SEAN MEREDITH BSCH, BSP, PHARM D, CD ROYAL CANADIAN MEDICAL SERVICE CPE Information and Disclosures Sean Meredith declares no conflicts of interest, real or apparent, and no financial interests

708 views • 48 slides
A SAF e R Approach to Child Custody Cases Involving Domestic Violence: Implementation Technical

A SAF e R Approach to Child Custody Cases Involving Domestic Violence: Implementation Technical

A SAF e R Approach to Child Custody Cases Involving Domestic Violence: Implementation Technical Assistance and Training Availability Through BWJP Loretta Frederick Senior Legal and Policy Advisor, BWJP Nancy Ver Steegh Professor of Law,

461 views • 23 slides
Case-based discussion: 1 History You are the clinician working on a busy ward and havent had a

Case-based discussion: 1 History You are the clinician working on a busy ward and havent had a

Case-based discussion: 1 History You are the clinician working on a busy ward and havent had a break for 8 hours. On your way to the toilet, the emergency buzzer goes off. A 62-year-old 00:57 man is having a tonic-clonic seizure. You are the

462 views • 33 slides
Disclosures Epilepsy Syndromes Zogenix-Contracted Research An evidence based era of novel

Disclosures Epilepsy Syndromes Zogenix-Contracted Research An evidence based era of novel

Disclosures Epilepsy Syndromes Zogenix-Contracted Research An evidence based era of novel treatments Epygenix-Consultant, Stock options Marinus Pharmaceuticals-Consultant Joseph Sullivan, M.D. Director, UCSF Pediatric Epilepsy Center

538 views • 7 slides
Epilepsy Vikram Rao, MD, PhD NeuroPace, Inc.: Consultant Diagnosis & Management Upsher

Epilepsy Vikram Rao, MD, PhD NeuroPace, Inc.: Consultant Diagnosis & Management Upsher

2/14/2019 Disclosures Epilepsy Vikram Rao, MD, PhD NeuroPace, Inc.: Consultant Diagnosis & Management Upsher Smith Laboratories: Served on Scientific Advisory Board Switch Bio, Inc.: Served on Scientific Advisory Board 2019 Neurona,

251 views • 12 slides

More recommend