lattice alignment
play

Lattice Alignment Align must be linear can be random reference - PDF document

Jan 30, 2023 •261 likes •1.47k views

Lattice Alignment Align must be linear can be random reference signals => coarse lattice fine (quantize) code KM DMAC i concentration points => coarse lattice fine (channel) code CO&F desired codewords => fine

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
Quadratic forms, lattice points and interference alignment Faustin ADICEAM (joint with Evgeniy

Quadratic forms, lattice points and interference alignment Faustin ADICEAM (joint with Evgeniy

Introduction The algebraic approach Some words about the geometric approach Workshop on Interactions between Number Theory and Wireless Communication, University of York ; July 05, 2016. Quadratic forms, lattice points and interference

881 views • 71 slides
What is text alignment? Text alignment is the comparison of two or more parallel texts It

What is text alignment? Text alignment is the comparison of two or more parallel texts It

A tool for syntax-based intra-language text alignment Tariq Yousef, Chiara Palladino University of Leipzig Berlin Digital Classicist Seminars, November 29, 2016 What is text alignment? Text alignment is the comparison of two or more

688 views • 53 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment Rezoning initiative is the implementation tool for the four new Transit Oriented Development (TOD) zoning districts. Parcels in station areas along

257 views • 14 slides
Lattice gas simulations Tony Kim Spring 2007 18.354 Project 1) Introducing the lattice gas;

Lattice gas simulations Tony Kim Spring 2007 18.354 Project 1) Introducing the lattice gas;

Lattice gas simulations Tony Kim Spring 2007 18.354 Project 1) Introducing the lattice gas; ntroducing the lattice gas; 2) Analytic description of the lattice gas; 3) Program objectives; 4) How to implement it (efficiently); 5)

321 views • 28 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail PUBLIC PRESENTATIONS Initial presentation to adjacent property owners in late

505 views • 24 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
Lattice QCD Outline 1. Lattice QCD (why and what) 2. Precision flavour physics 3. (g-2) on

Lattice QCD Outline 1. Lattice QCD (why and what) 2. Precision flavour physics 3. (g-2) on

Birmingham High Energy Physics Group - Particle Physics Seminar, University of Birmingham, 08.06.2016 Andreas Jttner Lattice QCD Outline 1. Lattice QCD (why and what) 2. Precision flavour physics 3. (g-2) on the lattice 4. Pushing

713 views • 52 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail COMPREHENSIVE PLAN Spokane features three major transportation pathways or

696 views • 25 slides
Lattice Points in Polytopes Richard P. Stanley U. Miami & M.I.T. A lattice polygon Georg

Lattice Points in Polytopes Richard P. Stanley U. Miami & M.I.T. A lattice polygon Georg

Lattice Points in Polytopes Richard P. Stanley U. Miami & M.I.T. A lattice polygon Georg Alexander Pick (18591942) P : lattice polygon in R 2 (vertices Z 2 , no self-intersections) Boundary and interior lattice points Picks

1.4k views • 120 slides
Lattice Methods in Field Theory Contents 1. Motivation 2. BasicsEuclidean quantisation 3.

Lattice Methods in Field Theory Contents 1. Motivation 2. BasicsEuclidean quantisation 3.

Lattice Methods in Field Theory Contents 1. Motivation 2. BasicsEuclidean quantisation 3. Lattice gauge fields Jonathan Flynn 4. Lattice fermions University of Southampton 5. Lattice QCD 6. Numerical simulations BUSSTEPP 2002

550 views • 22 slides
When is the lattice of closure operators on a subgroup lattice again a subgroup lattice? Martha

When is the lattice of closure operators on a subgroup lattice again a subgroup lattice? Martha

When is the lattice of closure operators on a subgroup lattice again a subgroup lattice? Martha Kilpack 1 and Arturo Magidin 2 1 Brigham Young University 2 University of Louisiana at Lafayette Groups St Andrews 2017 Martha Kilpack and Arturo

1.43k views • 77 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
MIMAC MIcro-tpc MAtrix of Chambers A Large TPC for Directional Dark Matter detection Daniel

MIMAC MIcro-tpc MAtrix of Chambers A Large TPC for Directional Dark Matter detection Daniel

MIMAC MIcro-tpc MAtrix of Chambers A Large TPC for Directional Dark Matter detection Daniel Santos Laboratoire de Physique Subatomique et de Cosmologie (LPSC-Grenoble) (UJF Grenoble 1 -CNRS/IN2P3-INPG) MIMAC (MIcro-tpc MAtrix of Chambers )

1.09k views • 50 slides
High-Statistics Calculation of Nucleon Structure and Matrix Elements on Isotropic Clover Lattices

High-Statistics Calculation of Nucleon Structure and Matrix Elements on Isotropic Clover Lattices

High-Statistics Calculation of Nucleon Structure and Matrix Elements on Isotropic Clover Lattices Combined LHP & NME Proposal LHP: S.Syritsyn(PI), J.Green, M.Engelhardt, N.Hasan, S.Krieg,J.Negele, S.Meinel, A.Pochinsky NME: R.Gupta(PI),

319 views • 14 slides
Norms Norm is a measure of size of a vector or matrix. Typical vector norms: Let v = [ v 1 , v

Norms Norm is a measure of size of a vector or matrix. Typical vector norms: Let v = [ v 1 , v

Norms Norm is a measure of size of a vector or matrix. Typical vector norms: Let v = [ v 1 , v 2 , . . . , v n ] T be a real vector. n n i ) 1 / 2 . v 2 v 1 = | v i | , v = max | v i | , v 2 = ( i i =1 i

258 views • 5 slides
Translations, rotations and homogeneous coordinates Basilio Bona DAUIN Politecnico di Torino

Translations, rotations and homogeneous coordinates Basilio Bona DAUIN Politecnico di Torino

Translations, rotations and homogeneous coordinates Basilio Bona DAUIN Politecnico di Torino Semester 1, 2016-17 B. Bona (DAUIN) Roto-translations Semester 1, 2016-17 1 / 12 Translations Translations are rigid displacements that move

601 views • 12 slides
Chapter 03 Segmentation, Targeting & Positioning (STP) Resource Person MATHISHA

Chapter 03 Segmentation, Targeting & Positioning (STP) Resource Person MATHISHA

Chapter 03 Segmentation, Targeting & Positioning (STP) Resource Person MATHISHA HEWAVITHARANA MBA (Col),BBA Sp.Mktng (Col), PPG DIP. In Mktng (UK), MCIM (UK), Chartered Marketer (UK), Practicing Marketer (SL), ACMA, CGMA CIMA (UK), DBF

487 views • 27 slides
Gender Classification with Support vector machines (SVMs) Support Vector Machines The 3

Gender Classification with Support vector machines (SVMs) Support Vector Machines The 3

Readings Supervised object recognition, Brief overview of classifiers in context of gender recognition: unsupervised object recognition http://www.merl.com/reports/docs/TR2000-01.pdf, Gender Classification with Support Vector Machines

548 views • 20 slides
Ina Ganguli a , Ricardo Hausmann b,c , Martina Viarengo b,d a University of Massachusetts Amherst b

Ina Ganguli a , Ricardo Hausmann b,c , Martina Viarengo b,d a University of Massachusetts Amherst b

Career Dynamics and Gender Gaps among Employees in the Microfinance Sector Ina Ganguli a , Ricardo Hausmann b,c , Martina Viarengo b,d a University of Massachusetts Amherst b Harvard Kennedy School and Center for International Development, Harvard

853 views • 47 slides
Improving Unsupervised Acoustic Word Embeddings using Speaker and Gender Information Lisa van

Improving Unsupervised Acoustic Word Embeddings using Speaker and Gender Information Lisa van

Improving Unsupervised Acoustic Word Embeddings using Speaker and Gender Information Lisa van Staden, Herman Kamper 31 January 2020 Zero-Resource Speech Processing Popular methods for speech processing rely on transcribed speech. Obtaining

602 views • 23 slides

More recommend