UCSF 2013 Operation CRISPR: Operation CRISPR: Deploying - - PowerPoint PPT Presentation

Operation CRISPR: Operation CRISPR:

Deploying ¡precision ¡guided ¡tools ¡to ¡target ¡ unique ¡species ¡in ¡a ¡complex ¡microbiome

¡

UCSF

2013

Microbiomes ¡play ¡an ¡important ¡role ¡in ¡ human ¡and ¡environmental ¡health ¡

Disruption of the balance in the microbiome is linked to many diseases.

2 ¡

3 ¡

Current ¡methods ¡of ¡manipula9ng ¡ microbiomes ¡are ¡nonspecific ¡

Antibiotics

Indiscriminant killing of good and bad bacteria

4 ¡

CHALLENGE: ¡ ¡how ¡do ¡we ¡target ¡specific ¡ bacteria ¡within ¡the ¡complex ¡microbiome ¡ popula9on ¡? ¡

?

• 1. How do we target one species in a population?
• 2. How do we give selected species nuanced instructions?

5 ¡

Our ¡Goals ¡

• 1. Design genetic system that can target selected

species in microbiome

• 2. Design system that can modulate targeted species

in nuanced way:

• eg. Regulation of growth, gene silencing, cell death

Tool: CRISPRi

6 ¡

Introducing ¡CRISPRi ¡to ¡a ¡bacterial ¡ community ¡

Amended from: Qi, et al. Cell, 2013

• CRISPRi utilizes

gRNAs

• Highly specific and

customizable

• Can take advantage
• f unique DNA

sequences to target specific bacterial species

Why use CRISPRi?

7 ¡

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡

CHALLENGES:

• 1. How do we introduce and spread CRISPRi

system throughout microbiome?

Conjugation with CRISPRi

8 ¡

• 1. ¡Conjuga9on ¡as ¡Delivery ¡Method ¡

¡

Chromosomal ¡ ¡ DNA Conjuga9ve ¡ plasmid Chromosomal ¡ ¡ DNA Conjuga9ve ¡ plasmid

Donor ¡cell Recipient ¡Cell

Conjugation is a naturally occurring mechanism bacteria use to transfer DNA.

9 ¡

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡

CHALLENGES:

• 1. How do we introduce and spread CRISPRi

system throughout microbiome?

• 2. How do we use CRISPRi to manipulate target

bacteria?

Conjugation with CRISPRi Synthetic CRISPRi circuits

10 ¡

• 2. ¡CRISPRi ¡Circuits ¡can ¡be ¡used ¡to ¡give ¡a ¡

selected ¡bacteria ¡specific ¡instruc9ons ¡ ¡

Elicit Response #1 Chemical Signal #1 Elicit Response #2 Chemical Signal #2

11 ¡

Specific ¡Bacterial ¡Targe9ng: ¡ ¡ Conjuga9on ¡with ¡CRISPRi ¡

Target Cell

Chromosomal DNA

Gene of Interest

Untargeted Cell

Chromosomal DNA

Untargeted Gene

Chromosomal DNA

CRISPRi

Conjugative plasmid

Donor Cell

12 ¡

Engineered ¡donor ¡cell Conjugative plasmid

PTet dCas9 gRNA tetR Pc

CRISPRi ¡ Combining and ¡Conjuga9on

CRISPRi

Chromosomal DNA Conjugative plasmid

13 ¡

Transfer ¡of ¡Conjuga9ve ¡Plasmid ¡ from ¡Donor ¡to ¡Pathogen ¡

Chromosomal DNA

Gene ¡of ¡Interest

Conjugative plasmid

Engineered ¡donor ¡cell Target ¡Cell

Chromosomal DNA

CRISPRi

Conjugative plasmid

14 ¡

Inhibi9on ¡of ¡Gene ¡Expression ¡ by ¡CRISPRi ¡

Target Cell

Chromosomal DNA

Gene of Interest

Conjugative plasmid dCas9 tetR PTet dCas9 gRNA Pc Gene of Interest gRNA

AACUUUCAGUUUAGCGGUCU

gRNA dCas9

AACUUUCAGUUUAGCGGUCU AACTTTCAGTTTAGCGGTCTCCC TTGAAAGTCAAATCGCCAGAGGG 15 ¡

Proof ¡of ¡Concept: ¡RFP ¡Repression ¡

Target Cell

Chromosomal DNA

RFP

Chromosomal DNA

CRISPRi

Conjugative plasmid

Donor Cell

16 ¡

Can we transfer the CRISPRi system by conjugation? Does conjugation work? Can CRISPRi system knock down RFP expression?

Chromosomal DNA Gene of Interest Conjugative plasmid

Chromosomal DNA CRISPRi

Conjugative plasmid

17 ¡

Conjuga9on ¡Assay ¡between ¡Donor ¡ and ¡Recipient ¡Strains ¡

Donor (carbenicillin, from plasmid) Recipient (chloramphenicol) Recipient + Plasmid, “Transconjugant” (carb + cam)

10 5 15 20 25 0h Cell Density (Cells/mL) 2h 5h 8h x105 Number of Transconjugants over Time

18 ¡

Can we transfer the CRISPRi system by conjugation? Conjugation works Can CRISPRi system knock down RFP expression?

ü

Chromosomal DNA Gene of Interest Conjugative plasmid

Chromosomal DNA CRISPRi

Conjugative plasmid

19 ¡

Does ¡our ¡CRISPRi ¡system ¡work? ¡

Chromosomal DNA

RFP

Target Cell

20 ¡

Knock-­‑Down ¡of ¡RFP ¡with ¡Directly ¡ Transformed ¡CRISPRi ¡

104 103 102

Mean RFP Fluorescence (a.u.) + CRISPRi Control

21 ¡

Can we transfer the CRISPRi system by conjugation? Conjugation works ¡ ¡CRISPRi system knocks down RFP expression

ü ü

Chromosomal DNA Gene of Interest Conjugative plasmid

Chromosomal DNA CRISPRi

Conjugative plasmid

22 ¡

Conjuga9on ¡of ¡CRISPRi ¡System: ¡ RFP ¡Knock-­‑down ¡via ¡Flow ¡Cytometry ¡

Count mRFP gRNA(+), dCas9(+) 0 102 103 104 105 104 103 102 Mean RFP Fluorescence (a.u.) gRNA(+), dCas9(+) Conjugation Control

23 ¡

We can transfer the CRISPRi system by conjugation! Conjugation works ¡ ¡CRISPRi system knocks down RFP expression

ü ü

ü

Chromosomal DNA Gene of Interest Conjugative plasmid

Chromosomal DNA CRISPRi

Conjugative plasmid

24 ¡

Chromosomal DNA Conjugative plasmid

Is ¡There ¡Any ¡Non-­‑Specific ¡Targe9ng? ¡

Chromosomal DNA

CRISPRi

Conjugative plasmid

GFP RFP

Strain kindly provided by Stanley Qi, UCSF

25 ¡

102 103 103 102 105 104 Mean RFP Fluorescence (a.u.) Mean GFP Fluorescence (a.u.)

Demonstra9ng ¡the ¡Specificity ¡of ¡ CRISPRi ¡

26 ¡

Our ¡CRISPRi ¡conjuga9on ¡system ¡is… ¡

¡ ¡Transferable ¡ ¡ ¡ ¡ ¡Tunable ¡ ¡ ¡ ¡ ¡Scalable ¡ ¡ ¡ ¡ ¡Specific ¡ ¡

Chromosomal DNA Gene of Interest Conjugative plasmid

Chromosomal DNA CRISPRi

Conjugative plasmid

gRNA

AACUUUCAGUUUAGCGGUCU

Chromosomal DNA Conjugative plasmid

GFP RFP

Chromosomal DNA Conjugative plasmid

GFP RFP

gRNA

AACUUUCAGUUUAGCGGUCU 27 ¡

CRISPRi ¡Specificity ¡in ¡a ¡Co-­‑culture ¡

Target Cell

Chromosomal DNA

RFP

Untargeted Cell

Chromosomal DNA

YFP

Chromosomal DNA

CRISPRi

Conjugative plasmid

Donor Cell

28 ¡

Future ¡direc9ons ¡of ¡CRISPRi ¡ Conjuga9on ¡System ¡

• Targeting endogenous genes
• Conjugation between different species
• Transfer of complex instructions, such as

synthetic circuit

http://www.denniskunkel.com/ 29 ¡

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡

CHALLENGES:

• 1. How do we introduce and spread CRISPRi

system throughout microbiome?

• 2. How do we use CRISPRi to manipulate target

bacteria?

Conjugation with CRISPRi Synthetic CRISPRi circuits

30 ¡

CRISPRi ¡Circuits ¡can ¡be ¡used ¡to ¡give ¡a ¡ selected ¡bacteria ¡specific ¡instruc9ons ¡ ¡

Response #2 Response #1 Low chemical signal High Chemical Signal

31 ¡

Desired ¡Output ¡of ¡CRISPRi ¡Circuit ¡

Response #1 Response #2 LEGEND

32 ¡

Desired ¡Promoter ¡Sensi9vity ¡

33 ¡

Decision ¡Making ¡with ¡CRISPRi ¡ ¡

GFP ¡

RFPi ¡ RFP ¡ GFPi ¡ dCas9 ¡

Chemical ¡ Signal ¡

¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Interference ¡ ¡ i ¡

KEY ¡

34 ¡

GFP ¡

RFPi ¡ RFP ¡ GFPi ¡

Chemical ¡ Signal ¡ Low ¡ concentra?on ¡

H L ¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Interference ¡ ¡ i ¡

KEY ¡

H L

GFP

Low ¡Inducer ¡Level ¡à ¡GFP ¡

35 ¡

GFP ¡

RFPi ¡ RFP ¡ GFPi ¡

Chemical ¡ Signal ¡ High ¡ concentra?on ¡

H L ¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Interference ¡ ¡ i ¡

KEY ¡

H L

RFP

High ¡Inducer ¡Level ¡à ¡RFP ¡

36 ¡

Desired ¡Promoter ¡Ac9vity

¡

To confer this decision making ability, we need two promoters that respond differently to the same inducer

Low ec50 High ec50

37 ¡

Characterizing ¡pLAC ¡& ¡pTET ¡ promoters ¡

We want:

• Low Basal Level
• Wide Dynamic Range

pLAC Dose Response Curve pTET Dose Response Curve

38 ¡

Addi9onal ¡Repressor ¡Sites ¡Can ¡ Alter ¡Promoter ¡Behavior ¡

Lac O1 Lac O3 LacI Lac O1 LacI

Oehler et al., Nucleic Acids Research, 2006

39 ¡

Engineering ¡pLAC ¡Sensi9vity ¡

+1 TSS

• 140
• 10
• 35

lacO1 lacO1 lacO1 lacO1 lacO3 (A) (B) Original (BBa_R0011) Engineered

40 ¡

Redesigned ¡pLAC ¡à ¡Lower ¡ Dynamic ¡Range ¡

pLAC_engineered ¡ pLAC_original ¡ Hill Fit of pLAC_engineered Hill Fit of pLAC_originial ¡

pLAC engineered pLAC original

41 ¡

ec50 ec50

Improved ¡Designs ¡for ¡Low ¡& ¡High ¡ Level ¡Promoters ¡

+1 TSS

• 140
• 10
• 35

lacO1 lacO1 lacO1 lacO1 lacO1 lacO1 lacO3 lacO3 (A) (B) (C) (D) Original (BBa_R0011) Engineered Low High

42 ¡

The ¡Outputs ¡of ¡Our ¡Promoters ¡ Changed ¡But ¡Sensi9vity ¡Did ¡Not ¡

pLAC High pLAC Low

43 ¡

ec50 ec50

New ¡Characterized ¡Promoters ¡

44 ¡

Future ¡Direc9ons: ¡Test ¡CRISPRi ¡ System ¡

GFP ¡

RFPi ¡ RFP ¡ GFPi ¡ pTET pLAC dCas9 ¡

45 ¡

These ¡Promoter ¡Induc9on ¡Curves ¡ Generate ¡the ¡Desired ¡Outcome ¡in ¡Our ¡ Model ¡

Maximum Output BL = 443.7 BH = 443.7*1.25 Ec50/half max Value kL = 11.45 kH = 17 PARAMETERS High inducible promoter has a higher ec50 AND HIGHER MAXIMUM OUTPUT

46 ¡

Our ¡Model ¡is ¡Capable ¡of ¡ Genera9ng ¡a ¡Two-­‑Tiered ¡Response ¡

47 ¡

Team ¡Accomplishments ¡

We have successfully constructed a specific gene repression system using CRISPRi that can be efficiently transmitted between cells by conjugation!

• Designed a scalable CRISPRi circuit that can choose

between two outcomes based on the level of input

• Created protocols and standards available on our Wiki

…

48 ¡

BioBrick ¡Parts ¡Submi`ed ¡and ¡ Characterized ¡

Promoters: We characterized the pLAC and pTET inducible promoters Part: BBa_R0011, pLAC Part: BBa_R0040, pTET Guide RNAs (gRNA) for CRISPRi: Submitted 4 guide RNAs. The GFP and RFP gRNA's have been tested and shown to work in our experiments and in published results. Csy4 Enzyme: RNA cleaving enzyme Csy4, which allows for gRNAs to be cleaved from a longer RNA transcript.

49 ¡

Team ¡Accomplishments ¡

We have successfully constructed a specific gene repression system using CRISPRi that can be efficiently transmitted between cells by conjugation!

• Designed a scalable CRISPRi circuit that can choose

between two outcomes based on the level of input

• Created protocols and standards available on our Wiki
• We have created a set of materials that can be used to

introduce synthetic biology to the public

50 ¡

Human ¡Prac9ces: ¡Outreach ¡at ¡SF ¡ Exploratorium ¡

• Presented at Exploratorium, at an evening event held once a

month with several thousand attendees.

• Short descriptions about the Central Dogma and Synthetic

Biology Techniques

• Produced a variety of materials that can be used to talk to

the public about synthetic biology.

51 ¡

UCSF iGEM 2013

Abraham Lincoln High School UC Irvine UC Santa Barbara UC Berkeley U Miami Peking Univ.

Eric Wong David Dinh Derrick Lee Felicity Jika Sherry Teng Kendall Kearns Verna Huang Priyanka Dadlani Ian Ergui JI Weiyue

52 ¡

UCSF 2013

Kay Aull Susan Chen Greg Fedewa John Haliburton Kara Helmke Graham Heimberg Benjamin Heineike Suzi LeBaron Tim Notton Anusuya Ramasubramanian Matt Rubashkin Thomas Stevens

Program ¡Mentors ¡and ¡Teachers ¡

Veronica Zepeda, Connie Lee, Wendell Lim

53 ¡

Thank ¡You!

54 ¡