Smoking Cessation Research: From the Laboratory to Health - - PowerPoint PPT Presentation

Smoking Cessation Research: From the Laboratory to Health Communication

Caryn Lerman, Ph.D.

Mary W. Calkins Professor Department of Psychiatry University of Pennsylvania clerman@mail.med.upenn.edu

Overview of Lecture

• Genetics and Smoking Cessation
• basic principles
• research examples
• role of health communication research
• Motivating Smokers to Seek Treatment
• anti-tobacco PSAs: message design and

evaluation

Why do people smoke? Why don’t people quit?

Because nicotine addiction is a brain disease, resulting from changes in brain structure and function following chronic nicotine exposure. To extract nicotine, the addictive chemical in tobacco

Nicotine Dependence Treatment

• There is a need to develop new treatment models

that can be readily translated to the clinical setting to maximize the effectiveness of nicotine dependence treatment.

• FDA-approved medications-- NRT, bupropion,

and varenicline-- are efficacious.

• BUT, as many as 70% of smokers do not maintain

abstinence with these medications

No response Response Adverse event

Genetic Variation in Drug Metabolizing Enzymes and Drug Targets Influences Therapeutic Outcomes

CGAGTCGTACCGTAGCGGCGAT GCTCAGCATGGCATCGCCGCTA CGAGTCGTACTGTAGCGGCGAT GCTCAGCATGACATCGCCGCTA

SNP = single nucleotide polymorphism

5’U Exon1 Exon2 Exon3 Exon4 Exon5 Exon6 Exon7 Exon8 3’U

Chromosomes Gene Base pairs

How does this work?

Genetic Variation in Nicotine Metabolizing Enzymes and Response to NRT

Open Label Trial of TN vs. NS (n=599)

Orientation & Screening NS + 7 sessions group counseling TN+ 7 sessions group counseling Follow-Up: EOT, 6-months, and 12-months Pre-treatment Assessment & Genotyping

95% retention rate

NICOTINE COTININE

TRANS-3’- HYDROXYCOTININE TRANS-3’- HYDROXYCOTININE

NICOTINE-1’-N-OXIDE

NORNICOTINE

NICOTINE

NICOTINE GLUCURONIDE

COTININE COTININE GLUCURONIDE

COTININE-N-OXIDE

NORCOTININE

TRANS-3’ HYDROXYCOTININE GLUCURONIDE

~ 80%

4.4% 13.0% 2.4% 2% 7.4%

Nicotine Metabolic Profile

9.8% 4.2% 12.6% 0.4% 33.6%

Benowitz et al CYP2A6

Genetically Slow Metabolizers have higher nicotine on the patch

Nicotine Patch Usage (# days worn)

6.0 6.5 7.0 7.5

(125) (5)

p=0.02 10 20 30

Plasma Nicotine ± SD (ng/mL)

(118) (5)

Malaiyandi et al, Mol Psychiatry 2006

Genetically Slow Metabolizers have lower usage & equal nicotine on spray

Nicotine Spray Usage (doses/day) Plasma Nicotine ± SD (ng/mL)

10 20 30

p<0.02

(109)

(11)

• 5

5 15 25

(98)

(7)

Malaiyandi et al, Mol Psychiatry 2006

Genetically Slow Metabolizers have lower 3HC/COT ratios

0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 p<0.01

3HC/COT

Slow (n=14) Normal (n=247) Intermediate (n=49)

Genotype Group

Malaiyandi et al, Mol Psychiatry 2006

Treatment Levels of Plasma Nicotine By Nicotine Metabolite Ratio and Treatment (Abstainers only, n=333 out of 480)

5 10 15 20 25

1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl

Patch Spray

Plasma Nicotine

3-HC: Cotinine Ratio in Quartiles

Lerman et al, Clinical Pharm. Therapeutics, 2006

Slow Fast

Smoking Cessation Rates by Nicotine Metabolite Ratio and Treatment

5 10 15 20 25 30 35 40 45 50

1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl 1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl

End of treatment 6-month

Transdermal Patch Nasal Spray % Quit n=480

Slow Fast

3-HC: Cotinine Ratio in Quartiles

Summary

• Genetically faster metabolizers of nicotine

smoke more and are less likely to quit

• A blood test might be used in the future to

screen smokers to determine likely success with a standard dose of nicotine patch, and/or need for a higher dose or alternate treatment.

Evaluating Anti-Smoking PSAs

Caryn Lerman, Ph.D. Mary W. Calkins Professor Deputy Director, Abramson Cancer Center

Supported by an NCI Center of Excellence in Cancer Communication Research Grant and a Transdisciplinary Tobacco Use Research Center grant at the University of Pennsylvania

How do We Motivate Smokers to Seek Treatment?

Mass Media Smoking Campaigns

• Mass media anti-smoking campaigns have had

some promising results, but outcomes have been inconsistent.

• To develop more effective anti-smoking PSAs,

there is a need for theory-driven experimental research on PSA effectiveness.

PSA Attributes

MESSAGE SENSATION VALUE: Formal features of the PSA, such as pace of cuts and edits, music, intensity. ARGUMENT QUALITY: Content feature

• f the PSA—specifically, the quality of

the center argument (reason) for not smoking.

Overarching Conceptual Model

Behavior Intentions

Attitudes Norms PSA

Arousal/ Affect Processing Recall Beliefs:

norms conseq. images efficacy

Smoking status/ past behavior Self- efficacy/Skills

Socio-environmental Influences/Constraints

Sensation-seeking

Activation theory Integrative theory/TRA

* * * * Priming Theory

MSV

Arg.

Project Aims

• 1. To test the main and interacting effects of PSA

message sensation value (MSV) and argument quality on smoking cessation treatment- seeking.

Hyp: Based on ELM, high MSV may distract and reduce counter-arguing; thus, effects of argument strength may be weaker for high MSV ads Alt Hyp: Based on activation theory, high MSV may lead to greater processing of arguments; thus, effects

• f argument strength may be stronger for high MSV

ads

• 2. To explore mediating cognitive mechanisms of

PSA effects.

Study Design & Procedures

Baseline Questionnaire View PSAs (as a set of 4)

• Psychophysiology assessment

Outcome Measures

• Beliefs, attitudes, intentions, etc

View PSAs (individually)

• Thought listing, processing,effectiveness

Recall Measures N=50 N=50 N=50 N=50 Argument Quality

Weak Strong

MSV

Low High

Physiologic Sensor Placement

corrugator (EMG) zygomatic (EMG) clavicle+forearm (HR) (hypo)thenar eminence (SC)

Measures

Baseline Covariates/Moderators

• Demographics, smoking history
• Sensation-seeking, need for cognition

Mediating Variables

• Arousal/Attention (physiological)
• Cognitive and emotional processing
• Recall

Outcome Variables

• Attitudes, beliefs, social norms
• Behavioral control/self efficacy
• Behavioral intention
• Calling the quit line

Phase I: PSA Rating and Selection

• 1. Categorizing Topics
• 2. Evaluating Message Sensation

Value

• 3. Evaluating Arguments

• 569 smoking-related PSAs were

categorized based on topic

• Selection based on:

Audience Target – Adults Behavioral Target – Quitting smoking/seeking treatment (second hand smoke-focus excluded)

PSA Categorization

Categorization of PSAs

Provoke Seeking Treatment/Quitting

• Knowledge About Smoking
• Manipulation by Tobacco Companies

Say No to Smoking/ Refusal Skills Promote Non-Smoking (Positive Consequences) Testimonials Negative Consequences – General Negative Consequences – Disease and Death Negative Consequences – Endangers Others Negative Consequences – Cosmetic Negative Consequences – Any

Reliability of Categorization

2 CECCR and 2 TTURC raters categorized the PSAs:

• TTURC raters were >90% in agreement

with Annenberg ratings

• TTURC raters were >95% in agreement

with each other

• Overall Kappa = 0.89, p<.001

Target Audience (adults)

15 59 42 10 20 30 40 50 60 70

Promote Tx-Seeking

• Neg. Conseq. (any)

Knowledge about smoking

# of PSAs (n=99)

• 2. Evaluating Message Sensation Value

PSAs differ in format, intensity and audiovisual

• features. Message Sensation Value (MSV) is a

measure of these attributes. Perceived Message Sensation Value (PMSV) is the subjective report of the MSV features. MSV is coded for visual, audio and content dimensions.

Morgan, Palmgreen, Stephenson, Hoyle, Lorch: J of Comm, 2003.

MSV Scoring (Kentucky/rPMSV Morgan et al) Category Item Scoring Length Time (seconds) Animation 0/1 Cuts 0=1-6; 1=7-14; 2=15+ Edits 0=1-6; 1=7-14; 2=15+ Faces count Special Visual Effect 0/1 Slow Motion 0/1 Fast Motion 0/1 Unusual Colors 0/1 Intense Moments 0/1 Visual

Highlighted items p<.1 for association with pMSV

MSV Scoring (Kentucky/rPMSV Morgan et al) Category Item Scoring Sound Saturation 0/1 Music 0/1 Sound Effects 0/1 Slow Voice 0/1 Audio Fast Voice 0/1 Acted out/ Talking Head 1 vs 0 Narrative 0/1 Surprise/Twist Ending 0/1 Celebrity 0/1 Unexpected Format 0/1 Content

0.00 1.00 2.00 3.00 4.00 5.00

rPMSV

10 20 30 40

Frequency

Mean = 1.6465

• Std. Dev. = 1.29609

N = 99

Distribution of PSAs by MSV score (N=99)

Inter-rater reliability of MSV scoring (2 raters): MSV scores from subset of 45 of 99 PSAs: Kendall’s Tau = 0.906, p<0.001.

• 3. Evaluating Arguments

Step 1: Argument Extraction Arguments were extracted in a 2-step process.

1) 2 raters viewed the PSAs and typed explicit and implicit messages from each PSA. 2) 2 new raters viewed PSAs and read previous arguments to form one statement reflecting argument of PSA.

Step 2: Argument Evaluation

Shopping mall-intercept study of 300 participants (149 female) who were each presented 12 PSA arguments such that each argument was presented a minimum of 36 times (36-38 times) during the study. All participants were current smokers (mean 17.5, sd = 11.7) who had smoked at least 100 cigarettes during their lifetime.

After each statement, participant was asked if the statement (rated 1 strongly disagree to 5 strongly agree):

Is a reason for quitting smoking that is BELIEVABLE Is a reason for quitting smoking that is CONVINCING Is a reason for quitting smoking that is NEW to me Is a reason for quitting smoking that APPLIES to me Gives a reason for quitting smoking that is IMPORTANT TO ME Put THOUGHTS in my mind about quitting smoking Put THOUGHTS in my mind about wanting to continue smoking Helped me feel CONFIDENT about quitting smoking Would help my friends quit smoking Made me want to quit smoking Overall, how much do you agree or disagree with the statement Is the reason given for quitting smoking a strong or weak reason

Descriptive Data on Argument Evaluation

Count 99 Mean 29.68 SD 2.23 Minimum 20.85 Maximum 33.03 Cronbach reliability .90

PSA Selection

0.00 1.00 2.00 3.00 4.00 5.00

rPMSV

• 2.00
• 1.00

0.00 1.00 2.00

z_score

1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00 21.00 22.00 23.00 24.00 25.00 26.00 27.00 28.00 29.00 30.00 31.00 32.00 33.00 34.00 35.00 36.00 37.00 38.00 39.00 40.00 41.00 42.00 43.00 44.00 45.00 46.00 47.00 48.00 49.00 50.00 51.00 52.00 53.00 54.00 55.00 56.00 57.00 58.00 59.00 60.00 61.00 62.00 63.00 64.00 65.00 66.00 67.00 68.00 69.00 70.00 71.00 72.00 73.00 74.00 75.00 76.00 77.00 79.00 80.00 81.00 82.00 83.00 84.00 85.00 86.00 87.00 88.00 89.00 90.00 91.00 92.00 93.00 94.00 95.00 97.00 98.00 99.00

• 1SD Mean +1SD

+1SD -1SD

High MSV Low MSV High Arg Low Arg High Arg Low Arg Age 48.5 (12.2) 44.4 (11.6) 44.0 (12.1) 44.7 (12.1) Sex (% male) 60.7 56.7 55.2 58.2 Race (% White) 59.0 60.0 58.1 60.0 Education (%HS) 64.3 55.3 64.1 67.0 Cigs per day 19.7 (8.8) 18.9 (9.4) 23.3 (14.1) 17.3 (8.2) FTND 5.1 (2.1) 5.3 (2.1) 5.0 (2.2) 4.9 (2.5)

Descriptive Statistics by PSA Condition (n=174/200)

0.1 0.2 0.3 0.4 0.5 0.6 0.7

High MSV Low MSV

Strong Arg Strong Arg Weak Arg Weak Arg

Heart Rate Change from Baseline by Condition

P=.07 for argument effect, controlling for MSV, age P=.01 for argument effect within High MSV

N=42 N=42 N=44 N=46

0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4

High MSV Low MSV

Strong Arg Strong Arg Weak Arg Weak Arg

Skin Conductance Change from Baseline by Condition

P=.02 for argument effect, controlling for MSV, age

N=42 N=42 N=44 N=46

0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16

High MSV Low MSV

Strong Arg Strong Arg Weak Arg Weak Arg

Corrugator Change from Baseline by Condition

P=.01 for MSV effect, controlling for argument and age P=.08 for argument effect, controlling for MSV, age

N=44 N=42 N=42 N=46

5 10 15 20 25

High MSV Low MSV

Strong Arg Strong Arg Weak Arg Weak Arg

Percent Calling Quit Line by Condition

N=42 N=42 N=44 N=46

Summary of Preliminary Results

• Effects of argument strength for heart rate and skin

conductance, plus marginal effect for corrugator

• Effects of MSV for corrugator (increased concentration, rather

than affective response?)

• No effects of condition on self-report measures of beliefs,

attitudes, or intentions

• Trend for increased rate of calling the quit line for high

MSV/high argument TENTATIVE INTERPRETATION: Physiological measures may be more sensitive to initial responses to PSAs than self- report measures……but, do these measures predict outcomes?

Analyses Underway

• Effects of condition on cognitive and emotional processing and

recall

• Relationship of physiological data to cognitive and behavioral
• utcomes
• Moderating influence of individual differences: nicotine

dependence, sensation seeking, need for cognition Limitations: Data are preliminary! Larger sample size needed to adjust for multiple comparisons and predict calling the quit line.

Future Directions

On-going fMRI and Eye-tracking studies utilizing the same PSAs.

Using Using fMRI fMRI to Improve Anti to Improve Anti-

• Tobacco

Tobacco PSAs PSAs

• Objective evidence-based

methods for PSA design and evaluation are needed

• Neuroimaging research can

identify the brain correlates

• f effective PSAs

Langleben et al., Department of Psychiatry

PSA Video: “Family Reunion” 30 sec Frame #1

00:01:32

Frame #2

00:11:56

Frame #3

00:21:02

Frame #4

00:25:77

Ultimate Objectives

• To improve treatments for smoking cessation
• To improve public communication about

tobacco use and motivate treatment-seeking.

• To reduce tobacco-related morbidity and

mortality.

Acknowledgements

• Joseph Cappella, Ph.D., Annenberg School

for Communication

• Andrew Strasser, Ph.D., Tobacco Use

Research Center

• William Shadel, Ph.D., Rand Corporation

NCI funding for CECCR and TTURC