for or Can Cance cer r The heragn gnos osis is Div Divisi - PowerPoint PPT Presentation

Ver ersa satili tility ty of of Nu Nucleic leic Acid Acid for or Can Cance cer r The heragn gnos osis is Div Divisi ision on of of Con Conver ergence gence Tec echnolog hnology Resear esearch h Instit Institute ute of of Na National C tional Cancer C ancer Center enter, , Rep ep. of . of K Kor orea ea Yun un-Hee Kim Hee Kim 1

Requirements for development of cancer gene therapeutics Nucleic acid-based therapy in vivo Imaging 2

mRNA Protein mRNA Target RISC Therapeutic RNA Replacement Protein Protein sysnthesis sysnthesis Inhibition of Results protein function Replaced protein  Gene Silencing: antisense RNA , ribozyme, RNAi, miRNA  RNA replacement: trans-splicing ribozyme, spliceosome  Modulating protein function: aptamer 3

General strategy of Nucleic acid-therapeutics 1) Inhibition of protein biosynthesis DNA Transcription mRNA Translation Antisense oligonucleotides • Ribozymes • Small interfering RNAs (siRNA) • Short hairpin RNAs (shRNA) • Micro RNA (miRNA) • Post translational modification Membrane Protein Protein or Protein replaced protein 4

Strategy of Nucleic acid-therapeutics 2) Capturing agents to bind protein DNA Transcription mRNA Translation Aptamer Post translational modification Membrane Protein Protein Protein 5

RNA replacement : trans-splicing Ribozyme Trans-splicing ribozyme G genome G Rz transcription Therapeutic RNA Target RNA 5’ U G G Rz 5’ U Therapeutic RNA expression by trans-splicing Trans-cleaving Trans-splicing translation Transgene expression 6

Multifun ltifunctional ctional Tumor or Targeting eting Devic ice e by y trans ans -sp splici licing ng ribozy ozyme me Dual Targeting Tissue specific Tumor promoting Promoter Ribozyme Therapeutic gene Ad Ad Ad Ad -HSV-Tk -Cytosine deaminase Target RNA Cytotoxic knock-down effect Anti-sense Direct anti-tumor effect effect Dual Therapy 7

Target et & therape peut utic ic gene e for r replac lacement ement in trans ns-spli plici cing ng riboz ozyme yme Target Therapeutic gene He Herpes pes simpl implex x th thymi ymidin dine kinas inase (HS HSVtk tk) ) hTERT : compo ponen nent t of t telomer omerase ase gene e - Cell death h by bystander ander effect - potent ntial ial anti-cance cancer r therapeu peutic tic target et - 1. Ribonucleoprotein enzyme that maintains the protective telomere structures (tandomly repeated (TTAGGG)n seq.) in eukaryotic chromosome 2. Expression level of hTERT relates with telomerase activity 3. Selective expression in highly proliferative cells (bone marrow stem cells, germ cells … ) and ~90% of cancer cells GCV : Ganciclovir • Well-known mechanism of action • Strong cell killing potential due to neighboring effect • No toxic effect without GCV • Expression can be monitored by PET in vivo 8

Multifunctional Devices(trans-splicing ribozyme) for Hepa patocel ocellular ular Carcinoma cinoma Ther erapy * I Image-aide ided d in vivo Eval alua uatio tion Y-H Kim et al. Theranostics (2016) 9

Multifunctional Devices(trans-splicing ribozyme) for Pancr crea eatic tic Cancer cer Therapy Target RNA: PAUF (pancreatic adenocarcinoma up-regulated factor) * I Image-aide ided d in vivo Eval alua uatio tion Y-H Kim et al. Cancer Letters (2014) 10

1. Target (tumor specificity, natural conformation, …) 2. Specific-Targeting efficiency 3. Penetration into tumor tissue Aptamer 4. Easy manipulation for optimization 5. Speed & Cost for development 6. Multiple targeting (simultaneously) - Complexity of tumor microenvironment <Advantages of aptamers> ● Specifically bind a target of interest ( K D = pM ~ nM) ● Produced by chemically process ( in vitro ) ● Conjugation chemistries are easy ● Smaller size allows tumor tissue penetration ● Able to select for cell-surface targets Trends in Pharmacological Sciences . 2008. 29(2);57 - 61 11

Modulating protein function : Aptamer  Latin: “ aptus ” – to fit  Oligonucleic acid (DNA or RNA) or peptide molecules that bind a specific target molecule  Aptamer can be thought of as the nucleic acid antibodies  Sequences are selected from very large pools (10 15 or greater)  Discovered through in vitro selection (SELEX) to recognize and specifically bind a target of interest SELEX : systematic evolution of ligands by exponential enrichment --Nucleic acid-based antibody 12

cell ,… : protein , sugar, SELEX Known target Known target Unknown target * Therapeutic aptamer development known cell surface proteins Cloning and Sequencing Protein as it appears Validation: target-specificity * Discovery of surface markers the specific cell types Optimization Cell itself as a target 13

PAUF-targeting Aptamer for known secretory target Protein-based SELEX  Aptamer L1, L2, L4, L6, L7, L8, L9, L10, L11, L14, L17, L18, L19 5 cycles 10 cycles 18 cycles CCTGTAAATACACGCATCGTATCTCGATTCGTATCCTTGACC L3 LBL313-Fc LBL313-Fc LBL313-Fc CCTGTAAATACACGCATCGTATCTCGATTCATATCCTTGACC L12 CCTGTAAATACACGCATCGTATCTCGATTCGCATCCCTGACT Fc Fc Fc L15, L20 CCTGTAAATACATTCTTCCGCGTGTGATACCGTCCGTGACTA L5 CCTGTAAATACACTGATCTTCCGATATGTTCCTGCCATCATAC PAUF targeting aptamer – in vivo function Tumor: CFPAC-1-Luc (pancreatic tumor cell) Aptamer: 10 day (every 2day injection) PBS Neutralizing antibody 12-FR2 Aptamer Reverse sequence (CTL) Y-H Kim et al. Cancer Letters (2012) 14

Pancreatic cancer -targeting Aptamer for unknown cell surface marker Why Cell-SELEX ? 1. Target identification (in case of unknown target) - binding to target & pulldown & purification 2. Specific recognition for target protein 3. Easy optimization for therapeutic utilization 4. Small size benefits-penetration, imaging probe, … & 1. Cell surface target without destruction of 3- dimentional structure (SELEX in live cells) 2. Recognition ability to small sized epitope 3. Recognition to tumor status-dependent modification of target 15

Control cell (HPNE) Negative control Target cell (Lu-M1) aptamer Aptamer candidates SQ8 SQ7 SQ8 SQ7 SQ1 library <Internalization> unpublished 16

Win-Win Win : Antibody ibody-ba based sed delivery ery of Aptame tamer Apta ptamer mer Antibo ntibody dy (O (Oli ligo gomer) mer) Oligob Ol igobod ody High stability in blood High penetration High stability in blood High penetration 17

Proof-of-Concept of Oligobody Anti-cotinine (Antibody) Increase pharmacokinetics Anti-VEGF (Aptamer) Increase tumor tissue penetration Inhibit tumor growth 18 Heo et al. J Contl Release (2016)

Oligobody: a novel aptamer-antibody hybrid complex Ab Ab Target 1 Apt1 antibody as Novel delivery tool of aptamer Target 2 Ab Apt2 Anti-Cotinine humanized antibody . High affinity against Cotinine ( K D = 4.9 X 10 -12 M) . Target 3 Apt3 Ab Increase pharmacokinetics of aptamer-conjugate . Need just one antibody!! . Simultaneously multi-targeting . Aptamer1 Cot Aptamers Aptamer2 Cot Targeting tool Hapten Aptamer3 Cot Bind to a specific target molecule Linking tool Fast generation, Low cost Aptamer4 Cot Low molecular weight (tissue penetration) Link between aptamer and antibody Chemistry for Conjugation Cotinine is not toxic Aptamer5 Cot Easy to synthesize with aptamer 19

Systemic administration Ref:Theranostics 04: 0931, No3 20

<Aptamer> <Pancreatic Cancer> Dr. Sang Myoung Woo - Dr. In-Hoo Kim Dr. Sang Jae Park - Dr. Kyun Heo Dr. Woo Jin Lee, - Dr. Sun Il Choi (Ph.D) Dr. Sung Sik Han - Dr. Jun-Ho Jung (SNU) Dr. Eun Kyoung Hong - Dr. Jin Sook Jeong (Dong-A Univ) Dr. Sun-Young Kong - Dr. Sang-Jin Lee - Dr. Eun Sook Lee - Dr. Ho Jin Sung - Dr. Kyoung Ho Choi (SNU) - Dr. Seok-ki Kim * All lab. members * Research Core Center, NCC 21