hidden markov models markov model finite state machine
play

Hidden Markov Models Markov Model (Finite State Machine with Probs) - PowerPoint PPT Presentation

Mar 10, 2023 •424 likes •692 views

Hidden Markov Models Markov Model (Finite State Machine with Probs) Modeling a sequence of weather observations Hidden Markov Models Assume the states in the machine are not observed and we can observe some output at certain states. Hidden

  1. Hidden Markov Models

  2. Markov Model (Finite State Machine with Probs) Modeling a sequence of weather observations

  3. Hidden Markov Models Assume the states in the machine are not observed and we can observe some output at certain states.

  4. Hidden Markov Models Assume the states in the machine are not observed and we can observe some output at certain states. Hidden: Sunny Hidden: Rainy Observation: Clean Observation: Walk Observation: Shop

  5. Generate a sequence from a HMM p ( s ( i + 1) | s ( i )) p ( s ( i ) | s ( i − 1)) Hidden s(i-1) s(i) s(i+1) Observed x(i-1) x(i) x(i+1) p ( x ( i + 1) | s ( i + 1)) p ( x ( i ) | s ( i )) p ( x ( i − 1) | s ( i − 1))

  6. Generate a sequence from a HMM HHHHHHCCCCCCCHHHHHH Hidden: temperature 3323332111111233332 Observed: number of ice creams

  7. Hidden Markov Models: Applications Speech recognition Action recognition

  8. Motif Finding Problem: Find frequent motifs with length L in a sequence dataset ATCGCGCGGCGCGGAATCGDTATCGCGCGCC CAGGTAAGT GCGCGCG CAGGTAAGG TATTATGCGAGACGATGTGCTATT GTAGGCTGATGTGGGGGG AAGGTAAGT CGAGGAGTGCATG CTAGGGAAACCGCGCGCGCGCGAT AAGGTGAGT GGGAAAG Assumption: the motifs are very similar to each other but look very different from the rest part of sequences

  9. Motif: a first approximation Assumption 1: lengths of motifs are fixed to L Assumption 2: states on different positions on the sequence are independently distributed N i ( A ) p i ( A ) = N i ( A ) + N i ( T ) + N i ( G ) + N i ( C ) L Y p ( x ) = p i ( x ( i )) i =1

  10. Motif: (Hidden) Markov models Assumption 1: lengths of motifs are fixed to L Assumption 2: future letters depend only on the present letter p i ( A | G ) = N i − 1 ,i ( G, A ) N i − 1 ( G ) L Y p ( x ) = p 1 ( x (1)) p i ( x ( i ) | x ( i − 1)) i =2

  11. Motif Finding Problem: We don’t know the exact locations of motifs in the sequence dataset ATCGCGCGGCGCGGAATCGDTATCGCGCGCC CAGGTAAGT GCGCGCG CAGGTAAGG TATTATGCGAGACGATGTGCTATT GTAGGCTGATGTGGGGGG AAGGTAAGT CGAGGAGTGCATG CTAGGGAAACCGCGCGCGCGCGAT AAGGTGAGT GGGAAAG Assumption: the motifs are very similar to each other but look very different from the rest part of sequences

  12. Hidden state space null start end

  13. Hidden Markov Model (HMM) 0.9 null 0.99 0.02 start end 0.08 0.95 0.01 0.05

  14. How to build HMMs?

  15. Computational problems in HMMs

  16. Hidden Markov Models

  17. Hidden Markov Model Hidden q(i-1) q(i) q(i+1) Observed o(i-1) o(i) o(i+1)

  18. Conditional Probability of Observations Example:

  19. Joint and marginal probabilities Joint: Marginal:

  20. How to compute the probability of observations

  21. Forward algorithm

  22. Forward algorithm

  23. Forward algorithm

  24. Decoding: finding the most probable states Similar to the forward algorithm, we can define the following value:

  26. Viterbi algorithm

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Hidden Markov Models Pratik Lahiri Introduction A hidden Markov model (HMM) is a

Hidden Markov Models Pratik Lahiri Introduction A hidden Markov model (HMM) is a

Hidden Markov Models Pratik Lahiri Introduction A hidden Markov model (HMM) is a statistical Markov model in which the system being modeled is assumed to be a Markov process with unobserved (hidden) states. We call the observed event

741 views • 13 slides
Markov Models Kunsch, H.R., State Space and Hidden Markov Models . ETH- Zurich, Zurich;

Markov Models Kunsch, H.R., State Space and Hidden Markov Models . ETH- Zurich, Zurich;

State Space and Hidden Markov Models Kunsch, H.R., State Space and Hidden Markov Models . ETH- Zurich, Zurich; Aliaksandr Hubin Oslo 2014 Contents 1. Introduction 2. Markov Chains 3. Hidden Markov and State Space Model 4. Filtering and

853 views • 37 slides
A C Standard model has 1-1 correspondence between symbols and states, P(A | T) thus P ( x i

A C Standard model has 1-1 correspondence between symbols and states, P(A | T) thus P ( x i

Outline Markov chains CSCE 471/871 Lecture 3: Markov Chains and Hidden Markov Models Hidden Markov models (HMMs) Formal definition Finding most probable state path (Viterbi algorithm) Stephen D. Scott Forward and backward

640 views • 5 slides
1 Real HMM Examples Real HMM Examples Speech recognition HMMs: Machine translation HMMs:

1 Real HMM Examples Real HMM Examples Speech recognition HMMs: Machine translation HMMs:

Hidden Markov Models CSE 473: Artificial Intelligence Markov chains not so useful for most agents Hidden Markov Models Eventually you dont know anything anymore Need observations to update your beliefs Hidden Markov models

567 views • 9 slides
1 Real HMM Examples Real HMM Examples Speech recognition HMMs: Machine translation HMMs:

1 Real HMM Examples Real HMM Examples Speech recognition HMMs: Machine translation HMMs:

Hidden Markov Models CSE 473: Artificial Intelligence Hidden Markov Models Markov chains not so useful for most agents Eventually you dont know anything anymore Need observations to update your beliefs Hidden Markov models (HMMs)

253 views • 7 slides
1 X 1 X 2 X 3 Ghostbusters HMM Chain Rule and HMMs E 1 E 2 E 3 P(X 1 ) = uniform 1/9 1/9

1 X 1 X 2 X 3 Ghostbusters HMM Chain Rule and HMMs E 1 E 2 E 3 P(X 1 ) = uniform 1/9 1/9

Hidden Markov Models 1 Hidden Markov Models Markov chains not so useful for most agents Need observations to update your beliefs Hidden Markov models (HMMs) Underlying Markov chain over states X You observe outputs (effects) at

617 views • 7 slides
CSE P 590 A Markov Models and Hidden Markov Models

CSE P 590 A Markov Models and Hidden Markov Models

CSE P 590 A Markov Models and Hidden Markov Models http://upload.wikimedia.org/wikipedia/commons/b/ba/Calico_cat Dosage Compensation Reminder: Proteins Read DNA and X-Inactivation E.g.: 2 copies (mom/dad) of each

1.28k views • 21 slides
Markov chains and Hidden Markov Models 9000 Markov chains and HMMs We will discuss: Markov

Markov chains and Hidden Markov Models 9000 Markov chains and HMMs We will discuss: Markov

Markov chains and Hidden Markov Models 9000 Markov chains and HMMs We will discuss: Markov chains Hidden Markov Models (HMMs) Algorithms: Viterbi, forward, backward, posterior decoding Profile HMMs Baum-Welch algorithm 9001

1.16k views • 87 slides
CSE 527 " Markov Models and Hidden Markov Models !

CSE 527 " Markov Models and Hidden Markov Models !

CSE 527 " Markov Models and Hidden Markov Models ! http://upload.wikimedia.org/wikipedia/commons/b/ba/Calico_cat ! Dosage Compensation Reminder: Proteins Read DNA ! and X-Inactivation ! E.g.: ! 2 copies (mom/dad) of each chromosome

770 views • 17 slides
CSE P 527 Markov Models and Hidden Markov Models 1 2

CSE P 527 Markov Models and Hidden Markov Models 1 2

CSE P 527 Markov Models and Hidden Markov Models 1 2 http://upload.wikimedia.org/wikipedia/commons/b/ba/Calico_cat Dosage Compensation and X-Inactivation 2 copies (mom/dad) of each chromosome 1-23 Mostly, both copies of each gene are

970 views • 66 slides
CSE 427 Markov Models and Hidden Markov Models 2

CSE 427 Markov Models and Hidden Markov Models 2

CSE 427 Markov Models and Hidden Markov Models 2 http://upload.wikimedia.org/wikipedia/commons/b/ba/Calico_cat Dosage Compensation and X-Inactivation 2 copies (mom/dad) of each chromosome 1-23 Mostly, both copies of each gene are

1.07k views • 60 slides
Hidden Markov Model (HMM) Sensor Markov assumption: P ( E t | X 0: t , E 1: t 1 ) = P ( E t | X

Hidden Markov Model (HMM) Sensor Markov assumption: P ( E t | X 0: t , E 1: t 1 ) = P ( E t | X

Hidden Markov Model (HMM) Sensor Markov assumption: P ( E t | X 0: t , E 1: t 1 ) = P ( E t | X t ) Stationary process: transition model P ( X t | X t 1 ) and Hidden Markov Models sensor model P ( E t | X t ) fixed for all t HMM is a

324 views • 3 slides
Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University 2 Markov Chains

Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University 2 Markov Chains

1 Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University 2 Markov Chains and Hidden Markov Models Modeling the statistical properties of biological sequences and distinguishing regions based on these models For the

437 views • 32 slides
Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University Markov Chains and

Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University Markov Chains and

Markov Chains and Hidden Markov Models COMP 571 Luay Nakhleh, Rice University Markov Chains and Hidden Markov Models Modeling the statistical properties of biological sequences and distinguishing regions based on these models For the

1.33k views • 96 slides
Hidden Markov Models Training Selecting model parameters What we know The terminology and

Hidden Markov Models Training Selecting model parameters What we know The terminology and

Hidden Markov Models Training Selecting model parameters What we know The terminology and notation of hidden Markov models ( HMMs ) The forward- and backward-algorithms for determining the likelihood p ( X ) of a sequence of

1.02k views • 60 slides
CSE 527 Lectures 11-12 Markov Models and Hidden Markov Models DNA Methylation CH 3 CpG - 2

CSE 527 Lectures 11-12 Markov Models and Hidden Markov Models DNA Methylation CH 3 CpG - 2

CSE 527 Lectures 11-12 Markov Models and Hidden Markov Models DNA Methylation CH 3 CpG - 2 adjacent nts, same strand (not Watson-Crick pair; p mnemonic for the phosphodiester bond of the DNA backbone) C of CpG is often (70-80%)

780 views • 55 slides
Farm Business Management: The Fundamentals of Good Practice Peter L. Nuthall Chapter 10

Farm Business Management: The Fundamentals of Good Practice Peter L. Nuthall Chapter 10

COMPLIMENTARY TEACHING MATERIALS Farm Business Management: The Fundamentals of Good Practice Peter L. Nuthall Chapter 10 Observation Skills COMPLIMENTARY TEACHING MATERIALS LEARNING OBJECTIVES Actively consider the different classes of

305 views • 13 slides
RAMBO: Run-time packer Analysis with Multiple Branch Observation Xabier Ugarte-Pedrero, Davide

RAMBO: Run-time packer Analysis with Multiple Branch Observation Xabier Ugarte-Pedrero, Davide

RAMBO: Run-time packer Analysis with Multiple Branch Observation Xabier Ugarte-Pedrero, Davide Balzarotti, Igor Santos, Pablo G. Bringas University of Deusto, Cisco Talos, Eurecom 13th Conference on Detection of Intrusions and Malware &

532 views • 35 slides
COMS 4721: Machine Learning for Data Science Lecture 21, 4/13/2017 Prof. John Paisley Department

COMS 4721: Machine Learning for Data Science Lecture 21, 4/13/2017 Prof. John Paisley Department

COMS 4721: Machine Learning for Data Science Lecture 21, 4/13/2017 Prof. John Paisley Department of Electrical Engineering & Data Science Institute Columbia University H IDDEN M ARKOV M ODELS O VERVIEW Motivation We have seen how Markov

679 views • 23 slides
Towards a Unified Framework for Learning from Observation Santiago Ontan (IIIA-CSIC, Spain)

Towards a Unified Framework for Learning from Observation Santiago Ontan (IIIA-CSIC, Spain)

Towards a Unified Framework for Learning from Observation Santiago Ontan (IIIA-CSIC, Spain) Jos L. Montaa (Universidad de Cantabria, Spain) Avelino J. Gonzalez (University of Central Florida, USA) Motivation Many disconnected

700 views • 35 slides
Chapter 1 Ordinary human inquiry Ordinary human inquiry Chapter 1 Tradition

Chapter 1 Ordinary human inquiry Ordinary human inquiry Chapter 1 Tradition

Chapter Outline Chapter Outline Looking for reality Looking for reality Chapter 1 Ordinary human inquiry Ordinary human inquiry Chapter 1 Tradition Tradition Authority Authority Human Inquiry and Human

69 views • 4 slides
ARTIFICIAL INTELLIGENCE Planning under uncertainty: POMDPs Lecturer: Silja Renooij These slides

ARTIFICIAL INTELLIGENCE Planning under uncertainty: POMDPs Lecturer: Silja Renooij These slides

Utrecht University INFOB2KI 2019-2020 The Netherlands ARTIFICIAL INTELLIGENCE Planning under uncertainty: POMDPs Lecturer: Silja Renooij These slides are part of the INFOB2KI Course Notes available from

785 views • 17 slides
Multi-Observation Elicitation July 2017 Sebastian Casalaina-Martin Colorado Rafael Frongillo

Multi-Observation Elicitation July 2017 Sebastian Casalaina-Martin Colorado Rafael Frongillo

Multi-Observation Elicitation July 2017 Sebastian Casalaina-Martin Colorado Rafael Frongillo Colorado Tom Morgan Harvard Bo Waggoner UPenn 1 / 11 Background: Properties of distributions Property or statistic of a probability distribution:

268 views • 22 slides
1. Introduction In this lecture we will derive the formulas for the symmetric two-sided prediction

1. Introduction In this lecture we will derive the formulas for the symmetric two-sided prediction

Lecture 32: The prediction interval formulas for the next observation from a normal distribution when is unknown 0/ 5 1. Introduction In this lecture we will derive the formulas for the symmetric two-sided prediction interval for the n + 1-st

75 views • 6 slides

More recommend