Chapter 3: Biological basis of life: genetics, cells, DNA 1 Types - PowerPoint PPT Presentation

Feb 13, 2023 •330 likes •460 views

Chapter 3: Biological basis of life: genetics, cells, DNA 1 Types of eukaryotic cells Somatic cells: cells of the body (hair, skin, tissue) Sex cells: (in mammals), ova and sperm (i.e., gametes) 2 Organelles 3 DNA -Directs cell activities

Chapter 3: Biological basis of life: genetics, cells, DNA 1
Types of eukaryotic cells Somatic cells: cells of the body (hair, skin, tissue) Sex cells: (in mammals), ova and sperm (i.e., gametes) 2
Organelles 3
DNA -Directs cell activities -Building blocks of all life-forms Nucleotide structure: Sugar + phosphate + base pairs A denine - T hymine G uanine - C ytosine Bases form complementary bonds 4
DNA replication 1. DNA unzips 2. Exposed bases attract complementary nucleotides 3. Two "parent" strands = templates for new strands 5
DNA replication 1. DNA unzips 2. Exposed bases attract complementary nucleotides 3. Two "parent" strands = templates for new strands 6
Proteins Structural proteins (keratin, collagen) Functional … regulate chemical activities (enzymes, hormones) 7
Proteins -Made of amino acid chains Amino acids -Sequence and number determine protein function Triplets: sequence of 3 DNA bases specifies amino acids 8
9
DNA vs RNA RNA -Single-stranded - Uracil base instead of thymine 10
Protein synthesis Part 1 (transcription) in the nucleus... - mRNA copies DNA bases three at a time ( triplets ) into codons Part 2 (translation) in the cytoplasm with ribosomes... - tRNA binds amino acids with complementary codons 11
Protein examples Hormones -Produced by specialized cells -Influence chemical reactions -Regulates various cell functions Hemoglobin binds oxygen to red blood cells... 12

Download Presentation

Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Unit 2: Biological basis of life, heredity, and genetics 1 Summary 1. Quiz info - Quiz next

Unit 2: Biological basis of life, heredity, and genetics 1 Summary 1. Quiz info - Quiz next Wednesday, 3-22 2. Wrap-up Ch 3 - Cell Division 3. Abduction 4. Mendel's Principles of Inheritance 2 Mitosis and Meiosis - types of cell division

522 views • 31 slides

Chapter 3 Water: Supports All Life Water is the biological medium on Earth Water and the

Slide 1 / 44 Slide 2 / 44 Chapter 3 Water: Supports All Life Water is the biological medium on Earth Water and the Fitness of All living organisms the Environment require water more than any other substance Most cells are surrounded by

343 views • 8 slides

Genetics DNA The Biological Bases of Behavior Chromosomes Genes Chapter 3

Genetics DNA The Biological Bases of Behavior Chromosomes Genes Chapter 3 Polygenic Twins Identical (monozygotic) Twin studies The Nervous System I. Central nervous system A. Brain, Spinal cord II. Peripheral nervous

372 views • 10 slides

Chapter 3 Water and the Fitness of the Environment Slide 2 / 44 Water: Supports All Life Water

Slide 1 / 44 Chapter 3 Water and the Fitness of the Environment Slide 2 / 44 Water: Supports All Life Water is the biological medium on Earth All living organisms require water more than any other substance Most cells are surrounded by

728 views • 44 slides

Biological properties and enucleation enucleation of of red red Biological properties and blood

Biological properties and enucleation enucleation of of red red Biological properties and blood cells from from human embryonic stem cells human embryonic stem cells blood cells Shi-Jiang Lu, Qiang Feng, Jennifer S. Park, Loyda Vida, Bao-Shiang

230 views • 20 slides

Genetics Review The chromosomal basis of inheritance provides an understanding of the pattern of

Genetics Review The chromosomal basis of inheritance provides an understanding of the pattern of passage of genes from parent to offspring Rules of Probability Rules of Multiplication Rule of Addition Mendelian Genetics Law of Segregation

651 views • 39 slides

By: Brooke Sheppard What is a Cell? Cells are the basic structure of life for all organisms.

By: Brooke Sheppard What is a Cell? Cells are the basic structure of life for all organisms. Cells are microscopic, which means we can only view cells under a microscope. There are animal cells and plant cells that have similarities as well

518 views • 18 slides

Chapter 2 Structure and functions of cells of the nervous system Cell Organelles

Chapter 2 Structure and functions of cells of the nervous system Cell Organelles cellstissues-- systems Cell-- Small compartments that hold all the biological equipment necessary to keep an organism alive and

400 views • 22 slides

Human Anatomy & Physiology Chapter 2 (emphasis on pages 47-58) Chemical Basis Of Life Matter

Human Anatomy & Physiology Chapter 2 (emphasis on pages 47-58) Chemical Basis Of Life Matter The stuff of the universe Anything that has mass and occupies space Mass vs. Weight (amount of matter vs. force) States of

869 views • 68 slides

A Crash Course in Genetics A Crash Course in Genetics General Overview: DNA Structure

A Crash Course in Genetics A Crash Course in Genetics General Overview: DNA Structure RNA DNA Replication Encoding Proteins Protein Folding Types of DNA Manipulating DNA PCR Biological Computation CPSC

378 views • 36 slides

CHAPTER I CHAPTER I From Biological From Biological to Artificial Neuron Model to Artificial

Ugur HALICI - METU EEE - ANKARA 11/18/2004 CHAPTER I CHAPTER I From Biological From Biological to Artificial Neuron Model to Artificial Neuron Model CHAPTER I : : From Biological CHAPTER I From Biological to Artificial Neuron Model to

277 views • 24 slides

CHAPTER IX IX CHAPTER Radial Basis Function Networks Radial Basis Function Networks CHAPTER IX

Ugur HALICI - METU EEE - ANKARA 12/12/2005 CHAPTER IX IX CHAPTER Radial Basis Function Networks Radial Basis Function Networks CHAPTER IX : IX : Radial Basis Function Networks Radial Basis Function Networks CHAPTER Introduction Radial

309 views • 8 slides

Antigen Processing and Presentation Chapter 8 Antigen Recognition by T Cells T cells

Antigen Processing and Presentation Chapter 8 Antigen Recognition by T Cells T cells recognize linear peptides not whole proteins. T cells only recognize epitopes when they are complexed to MHC molecules. Therefore protein

548 views • 43 slides

Attraction-Repulsion Forces Tidal Forces Scale Invariance Between Biological Cells: Definitions

Biological Calls Interact Qualitative . . . Analyticity Attraction-Repulsion Forces Tidal Forces Scale Invariance Between Biological Cells: Definitions Main Results A Theoretical Explanation Proofs of Empirical Formulas Home Page Title

321 views • 14 slides

Gregor Mendel What is Genetics? the study of heredity Gregor Mendels Peas Born in 1822.

Gregor Mendel What is Genetics? the study of heredity Gregor Mendels Peas Born in 1822. Pollen: plants sperm His work with pea Egg Cells: plants plants laid the reproductive cells foundation for Genetics. Fertilization:

372 views • 33 slides

Intro to Cell Mechanics 1.28.16 Biological Hierarchy- Whole Body Tennis Anatomy (2011)

Intro to Cell Mechanics 1.28.16 Biological Hierarchy- Whole Body Tennis Anatomy (2011) Biological Hierarchy Muscles to Cells Biological Hierarchy Cells to Proteins Muscles contract via sliding the myosin and actin filaments along each

658 views • 32 slides

Benjamin LINARD Thesis director : Julie Thompson Guideline 1) General context 2) EvoluCodes:

Team leader: O. Poch EvoluCode: an original view of Director : Julie Thompson Human Systems Evolution. Benjamin LINARD Thesis director : Julie Thompson Guideline 1) General context 2) EvoluCodes: evolutionary barcodes 3) Evolutionary

697 views • 27 slides

Structural Bioinformatics Davide Ba Staff Scientist Genome Biology Group (CNAG) Structural

Structural Bioinformatics Davide Ba Staff Scientist Genome Biology Group (CNAG) Structural Genomics Group (CRG) dbau@pcb.ub.cat Course outline Davide Francisco Day 1-3 Protein structure Nucleic acids structure (3D modeling of the

768 views • 51 slides

Tiling of triply-periodic minimal surfaces (Hyperbolic tilings in soft matter physics) Myfanwy E.

Tiling of triply-periodic minimal surfaces (Hyperbolic tilings in soft matter physics) Myfanwy E. Evans Mathematics, Technische Universitt Berlin + Theoretical Physics, University of Erlangen-Nuremberg Applied Mathematics, Australian National

968 views • 31 slides

Meet the Amniotes: The great terrestrial adaptation Pterosauria Archaic archosaurs Dinosauria

Meet the Amniotes: The great terrestrial adaptation Pterosauria Archaic archosaurs Dinosauria Crocodiles Lepidosaurs Anapsids Synapsids Most amphibians Most fishes Amniota Assorted jawless fish Tetrapoda Urochordata

599 views • 33 slides

Introduction Thursday - Saturday May 22-24, 2014 The goal of the presentation is to acquaint

5/24/2014 30 th Annual Current Issues in Anatomic Pathology Introduction Thursday - Saturday May 22-24, 2014 The goal of the presentation is to acquaint you with some uncommon skin cancers and novel settings in which skin cancers may be

397 views • 18 slides

Malaysian Healthy Ageing Society Healthy Ageing from molecules to hormesis Aarhus University -

Organised by: Co-Sponsored: Malaysian Healthy Ageing Society Healthy Ageing from molecules to hormesis Aarhus University - library Aarhus University science park Biogerontology, class Molecular Biology Dept Suresh Rattan, PhD, DSc

535 views • 38 slides

Genomic and epigenomic signatures

ATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA TATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC

107 views • 10 slides

Toward a More Accurate Genome: Algorithms for the Analysis of High- Throughput Sequencing Data

Toward a More Accurate Genome: Algorithms for the Analysis of High- Throughput Sequencing Data Dissertation Defense W. Jacob B. Biesinger Tuesday, May 27th AREM TreeHMM Applied statistics Genomix Applied computer science ChIP-seq

881 views • 75 slides