analysis of hiv 1 specific ctl in the d sseldorf patient

Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas - PowerPoint PPT Presentation

Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas Harrer Infectious Diseases and Immunodeficiency Unit Department of Medicine 3 Dsseldorf Patient: HIV-1-specific Immunity? Did the new host develop an HIV-1-specific


  1. Analysis of HIV-1-specific CTL in the „Düsseldorf“ Patient Thomas Harrer Infectious Diseases and Immunodeficiency Unit Department of Medicine 3

  2. Düsseldorf Patient: HIV-1-specific Immunity?  Did the new host develop an HIV-1-specific immunity?  If yes, how strong is the HIV-1-specific CTL response  High frequencies of HIV-1-specific CTL would indicate active HIV-1 replication and HIV-1 persistence  HIV-1-specific CTL could play an important role in the eradicaton of the HIV-1 reservoir 2

  3. Analysis of HIV-1-specific CTL: 2015/ 2016 ( patient still on tacrolimus)  HLA-I type: A2,A24, B7, C7  ELISPOT with freshly isolated PBMC:  PBMC were isolated by Ficoll and rested overnight in R10  ELISPOT with 12 peptides corresponding to known CTL epitopes and two proteins  A2: p17-SL9, RT: IV9, VL9, VL9-V, YV9, PR: KI10-M Nef: PL10, PL10-F.  A24: gp41-EL9, p24-Il8  B7: Nef: FL9, FL9-T, TM9, RL9,  C7: Nef-RY10  20-AA long Gag-Peptides 2 and 5.  Proteins: gp120, p24  positive control: PHA  3

  4. Analysis of HIV-1-specific CTL:  Results:  very weak response to PHA due to immunosuppression  no significant specifc response to peptides  non-significant reaction to Nef7-FL9 No peptide PHA PHA in other patient 4

  5. Analysis of HIV-1-specific CTL: Peptide Stimulation Assay Stimulation with Peptides + IL2 für 1-2 weeks, then ELISPOT  detects low frequency CTL (1: 2-5 Mill.)  detects naive cells and resting memory cells  PBMC were stimulated with 6 peptides corresponding to known CTL epitopes in R10 + IL2  Peptides used for stimulation:  P17-SL9, RT IV9, RT YV9, Nef-TM9, gp41-EL9, Nef-RY10  Outgrowing cell lines were tested after two weeks for peptide recognition in a γ -IFN ELISPOT assay 5

  6. Recognition of RT-peptide YV9 by peptide stimulated CTL no peptide RT-YV9 peptide no peptide RT-YV9 peptide Blood from 10/ 2015 Blood from 2/ 2016 Limiting dilution assays revealed a CTL precursor frequency of ~ 1: 2000 cells within the PBMC 6

  7. DP: PBMC: d32 1 – H2O ctgcagctctcattttccata catt aaa 2 – CCR5 wt gatagtcatcttggggctggtcctgcc 3 – CCR5∆32 heterozygous gctgcttgtcatggtcatctgctactcg 4 – CCR5∆32 homoygous ggaatcctaaaaactctgcttcggtgt 5 – PBMC patient cgaaatgagaagaagaggcacaggg 6 RTYV9-CTL line ctgtgaggcttatcttcaccatcatgat 7 –Nef-fl9-line tgtttattttctcttctgggctccctaca acattg 8 – GenLadder 50bp (Genaxxon) 9 – Low Molecular Weight DNA DP RT YV9-CTL line: d32 Ladder ( NEB) ctgcagctctcattttccata catt aaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg The RTYV9 CTL ggaatcctaaaaactctgcttcggtgt cGaaatgagaagaagaggcacagg carry the d32 deletion in CCR5 gctgtgaggcttatcttcaccatcatga ttgtttattttctcttctgggctccctaca acattgtccttctcctgaa The RTYV9 CTL are donor derived

  8. Peptide stimulation assays with peptide pools 7/ 2016 Epitope mapping peptide pool 12/ 13 1200 1000 800 600 400 200 0  KL9: not recognized KELYPLASL EPID KELYPLASLRS 120 not recognized KE LYPLASLRSL FGN 121 recognized PLASLRSLFGN DPSS 122 not recognized LYPLASLRSL recognized L Y PLASLRS L A24 epitope Y P LASLRS L B7 epitope 8

  9. HLA-restriction analysis of Gag07-121-specific CTL A2,A24 128 A2,B7 92 A2,B7,C7 163 C7 2 A2 5 A2A24,B7,C7 97 0 50 100 150 200 The association with HLA B7 and HLA A24 demonstrates that both the HLAB7- and the HLA-A24-restricted CTL epitopes within GAG07-121 were recognized. 9

  10. The recognized Gag peptide is located in a functional late domain region of p6 late domains promote the release of virus particles from the plasma membrane. The primary Alix binding sequence is located near the C-terminus of p6, between residues 36 and 44 ( 36 YPLASLRSL 44 ) with p6- Y36, L41, and L44 being particularly critical for Gag– Alix binding . 10

  11. Stem cell donor : Test on 10 th of Jan.2018  Elispot with freshly isolated PBMC: 250 000 cell/ well  RT50YV9: A2  Gag07-121, YL9, LL19  Nef7-V2: B7  Nef11T3: C7  PHA: weak response, transport issue?  Stimulation of 5 Mill. PBMC each with peptides corresponding to CTL epitopes recognized by the Düsseldorf patient.  Gag07-121  Gag-LL10: A24  YL9: B7  RTYV9: A2  No significant response 11

  12. Düsseldorf-Patient: 14.March 2018  Elispot with freshly isolated PBMC: 200 000 cells/ Well  37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV. Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold 12

  13. Düsseldorf-Patient: 14.3.18  Stimulation of 5 Million PBMC with peptides:  Testung after 10 days: RT50 YV9 (A2): YQYMDDLV +++ RT50yV9 Gag7-121 : KE LYPLASLRSL FGN + + LL10: L Y PLASLRS L + + A24/B27 epitope YL9: Y P LASLRS L - B7 epitope 13

  14. Gag-specific CTL lines contain the Delta32-CCR5-Deletion 1. B-cell wild type 1 2 3 4 5 6 2. Düsseldorf patient B-cell 3. DNA ladder 4. B-cell heterozygous 5. Düsseldorf patient Gag CTL 6. Negative control 14

  15. Summary I:  The donor developed HIV-1-specific CTL against three functional important CTL epitopes in RT and Gag  Despite tacrolimus therapy, CTL lines against RT YV9 and GAG epitopes grew well after peptide stimulation  These CTL were not detectable in ELISPOT assays with freshly isolated PBMC presumably to the iatrogenic immunosuppression. 15

  16. Summary II: After Stopp of Tacrolimus in 2018:  No detection of CTL effector cells using freshly isolated PBMC in g-IFN- ELISPOT assays  Good outgrowth of CTL after stimulation with peptides and IL2.  This may be due to  Low frequency of effector CTL (<1:100 000)  Presence of memory cells which have not seen virus for a while and thus need costimulation in addition to the peptide.  This is indicating that viral replication is absent or low below threshold of immune activation.  However, this cannot rule out small amounts of residual virus. 16

  17. Summary III:  CTL against these epitopes were not detected in the donor´s PBMC.  This indicates that the new donor developed an immune response to HIV-1 surviving transplantation procedure despite strong immunosuppression  HIV-1-specific CTL could help to decrease viral reservoirs:  Graft versus virus response could help in clearance of HIV. 17

  18. Acknowledgment Christiane Mummert Silke Bergmann Björn Jensen Guido Kobbe Rolf Kaiser, Elena Knops, Eva Heger 18

  19. Peptide pool 12/ 13 is recognized by CD8+ T-cells Addition of anti-CD8-antibodies blocks T-cell recognition in the ELISPOT assay 19

Recommend


More recommend