Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas - - PowerPoint PPT Presentation

Analysis of HIV-1-specific CTL in the „Düsseldorf“ Patient

Thomas Harrer

Infectious Diseases and Immunodeficiency Unit Department of Medicine 3

Düsseldorf Patient: HIV-1-specific Immunity?

2

• Did the new host develop an HIV-1-specific immunity?
• High frequencies of HIV-1-specific CTL would indicate

active HIV-1 replication and HIV-1 persistence

• HIV-1-specific CTL could play an important role in the

eradicaton of the HIV-1 reservoir

Analysis of HIV-1-specific CTL:

3

 HLA-I type: A2,A24, B7, C7  ELISPOT with PBMC:

• PBMC were isolated by Ficoll and rested overnight in R10
• ELISPOT with 12 peptides corresponding to known CTL epitopes

and two proteins

• A2: p17-SL9, RT: IV9, VL9, VL9-V, YV9, PR: KI10-M

Nef: PL10, PL10-F.

• A24: gp41-EL9, p24-Il8
• B7: Nef: FL9, FL9-T, TM9, RL9,
• C7: Nef-RY10
• 20-AA long Gag-Peptides 2 and 5.
• Proteins: gp120, p24
• positive control: PHA



Analysis of HIV-1-specific CTL:

4

 Results:

• very weak response to PHA due to immunosuppression
• no significant specifc response to peptides
• non-significant reaction to Nef7-FL9

No peptide PHA PHA in other patient

Analysis of HIV-1-specific CTL: II

5

Analysis of CTL precursor by peptide stimulation

 PBMC were stimulated with 6 peptides corresponding

to known CTL epitopes in R10 + IL2

 Peptides used for stimulation:

• P17-SL9, RT IV9, RT YV9, Nef-TM9, gp41-EL9, Nef-RY10

 Outgrowing cell lines were tested after two weeks for

peptide recognition in a γ-IFN ELISPOT assay

Recognition of RT-peptide YV9 by peptide stimulated CTL no peptide RT-YV9 peptide

6

Blood from 10/ 2015 Blood from 2/ 2016 RT-YV9 peptide no peptide

1 – H2O 2 – CCR5 wt 3 – CCR5∆32 heterozygous 4 – CCR5∆32 homoygous 5 – PBMC patient 6 RTYV9-CTL line 7 –Nef-fl9-line 8 – GenLadder 50bp (Genaxxon) 9 – Low Molecular Weight DNA Ladder ( NEB)

DP: PBMC: d32 ctgcagctctcattttccatacattaaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg ggaatcctaaaaactctgcttcggtgt cgaaatgagaagaagaggcacaggg ctgtgaggcttatcttcaccatcatgat tgtttattttctcttctgggctccctaca acattg DP RT YV9-CTL line: d32 ctgcagctctcattttccatacattaaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg ggaatcctaaaaactctgcttcggtgt cGaaatgagaagaagaggcacagg gctgtgaggcttatcttcaccatcatga ttgtttattttctcttctgggctccctaca acattgtccttctcctgaa

The RTYV9 CTL carry the d32 deletion in CCR5 The RTYV9 CTL are donor derived

Limiting Dilution Analysis: Frequency of RTYV9-specific precursor CTL

8

Serial dilution of PBMC: 10, 100, 250, 500, 1000, 2000, 4000, 8000, 16000 per well + 50 000 irradiated feeder cells + 25 000 irradiated T2-cells loaded with YV9 peptide in R10/ IL2 24 replicates per dilution Elispot-analysis for peptide recognition after 20 and 23 days.

Limiting Dilution Analysis: Frequency of RTYV9-specific precursor CTL

9 10 20 30 40 50 60 70 80 90 100 110 1 10 100 1000 10000 100000

~1: 2000 in PBMC

37.5 %

% + out of 24 replicates dilution

2000 4000

ELISPOT with freshly isolated PBMC:

July 2016

 No reversion of tacrolimus induced anergy by IL2

and IL7 (100 ng/ ml each)

 no stimulus  RT YV9  PHA

10

no gamma-IFN-secreting T-cells

Peptide Stimulation 7/ 2016:

 stimulation with RT YV9 and with Nef and Gag peptide pools

spanning whole Nef and Gag proteins:

 Nef-Pool 20 peptides 20 aa long peptides

with a 10 aa overlap

 13 Gag pools with 10 peptides each except for pool 13 with 3

peptides (123 peptides, 15 aa long)

 Gag pools 10-13

11

12

Peptide pool 12/ 13 is recognized by CD8+ T-cells Addition of anti-CD8-antibodies blocks T-cell recognition in the ELISPOT assay

13

200 400 600 800 1000 1200

Epitope mapping peptide pool 12/ 13

EPIDKELYPLASLRS 120 not recognized KELYPLASLRSLFGN 121 recognized PLASLRSLFGNDPSS 122 not recognized YPLTSLRSLFGN p15-13.2: weak recognition LYPLASLRSL A24 epitope YPLASLRSL B7 epitope

The recognized Gag peptide is located in a functional late domain region of p6

14

late domains promote the release of virus particles from the plasma membrane. The primary Alix binding sequence is located near the C-terminus of p6, between residues 36 and 44 ( 36YPLASLRSL44) with p6- Y36, L41, and L44 being particularly critical for Gag– Alix binding .

Summary I:

 The donor developed HIV-1-specific CTL against two

functional important CTL epitopes in RT and Gag

 These CTL were not detectable in ELISPOT assays with

freshly isolated PBMC presumably due to iatrogenic immunosuppression.

 The CTL lines showed a strong g-IFN – production despite

• f prior immunosuppressive therapy

15

Summary II:

 This indicates that the new donor developed an immune

response to HIV-1 surviving transplantation procedure despite strong immunosuppression

 HIV-1-specific CTL could help to decrease viral reservoirs.

16

Acknowledgment

Christiane Mummert Silke Bergmann Björn Jensen Guido Kobbe Rolf Kaiser

17

p6 region of its Gag precursor protein, Pr55Gag.

EPIDKELYPLASLRS not recognized KELYPLASLRSLFGN recognized PLASLRSLFGNDPSS not recognized YPLTSLRSLFGN weaker recognition LYPLASLRSL A24 epitope YPLTSLRSL B7 epitope The patient recognizes atleast the B7 epitope probably also the A24 epitope.

18