Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas - - PowerPoint PPT Presentation

Analysis of HIV-1-specific CTL in the „Düsseldorf“ Patient

Thomas Harrer

Infectious Diseases and Immunodeficiency Unit Department of Medicine 3

Düsseldorf Patient: HIV-1-specific Immunity?

2

• Did the new host develop an HIV-1-specific immunity?
• If yes, how strong is the HIV-1-specific CTL response
• HIV-1-specific CTL could play an important role in the

eradicaton of the HIV-1 reservoir

• High frequencies of HIV-1-specific CTL would indicate

active HIV-1 replication and HIV-1 persistence

• Secondary decline of HIV-1-specific CTL indicate lack of

antigenic stimulation.

Analysis of HIV-1-specific CTL: 2015/ 2016

( patient still on tacrolimus)

3

 HLA-I type: A2,A24, B7, C7  ELISPOT with freshly isolated PBMC:

• PBMC were isolated by Ficoll and rested overnight in R10
• ELISPOT with 12 peptides corresponding to known CTL epitopes

and two proteins

• A2: p17-SL9, RT: IV9, VL9, VL9-V, YV9, PR: KI10-M

Nef: PL10, PL10-F.

• A24: gp41-EL9, p24-Il8
• B7: Nef: FL9, FL9-T, TM9, RL9,
• C7: Nef-RY10
• 20-AA long Gag-Peptides 2 and 5.
• Proteins: gp120, p24
• positive control: PHA



Analysis of HIV-1-specific CTL:

4

 Results:

• very weak response to PHA due to immunosuppression
• no significant specifc response to peptides
• non-significant reaction to Nef7-FL9

No peptide PHA PHA in other patient

Analysis of HIV-1-specific CTL: Peptide Stimulation Assay

5

Stimulation with Peptides + IL2 für 1-2 weeks, then ELISPOT

• detects low frequency CTL (1: 2-5 Mill.)
• detects naive cells and resting memory cells

 PBMC were stimulated with 6 peptides corresponding

to known CTL epitopes in R10 + IL2

 Peptides used for stimulation:

• P17-SL9, RT IV9, RT YV9, Nef-TM9, gp41-EL9, Nef-RY10

 Outgrowing cell lines were tested after two weeks for peptide

recognition in a γ-IFN ELISPOT assay

Recognition of RT-peptide YV9 by peptide stimulated CTL no peptide RT-YV9 peptide

6

Blood from 10/ 2015 Blood from 2/ 2016 RT-YV9 peptide no peptide Limiting dilution assays revealed a CTL precursor frequency of ~ 1: 2000 cells within the PBMC

1 – H2O 2 – CCR5 wt 3 – CCR5∆32 heterozygous 4 – CCR5∆32 homoygous 5 – PBMC patient 6 RTYV9-CTL line 7 –Nef-fl9-line 8 – GenLadder 50bp (Genaxxon) 9 – Low Molecular Weight DNA Ladder ( NEB)

DP: PBMC: d32 ctgcagctctcattttccatacattaaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg ggaatcctaaaaactctgcttcggtgt cgaaatgagaagaagaggcacaggg ctgtgaggcttatcttcaccatcatgat tgtttattttctcttctgggctccctaca acattg DP RT YV9-CTL line: d32 ctgcagctctcattttccatacattaaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg ggaatcctaaaaactctgcttcggtgt cGaaatgagaagaagaggcacagg gctgtgaggcttatcttcaccatcatga ttgtttattttctcttctgggctccctaca acattgtccttctcctgaa

The RTYV9 CTL carry the d32 deletion in CCR5 The RTYV9 CTL are donor derived

Peptide stimulation assays with peptide pools 7/ 2016

8

200 400 600 800 1000 1200

Epitope mapping peptide pool 12/ 13 

KELYPLASL KL9: not recognized EPIDKELYPLASLRS 120 not recognized KELYPLASLRSLFGN 121 recognized PLASLRSLFGNDPSS 122 not recognized LYPLASLRSL recognized LYPLASLRSL A24 epitope YPLASLRSL B7 epitope

Stem cell donor : Test on 10th of Jan.2018



Elispot with freshly isolated PBMC: 250 000 cell/ well

• RT50YV9: A2
• Gag07-121, YL9, LL19
• Nef7-V2: B7
• Nef11T3: C7
• PHA: weak response, transport issue?



Stimulation of 5 Mill. PBMC each with peptides corresponding to CTL epitopes recognized by the Düsseldorf patient.

• Gag07-121
• Gag-LL10: A24
• YL9: B7
• RTYV9: A2
• No significant response

9

Düsseldorf-Patient: 14.March 2018



Elispot with freshly isolated PBMC: 200 000 cells/ Well



37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV.

10

Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold

Düsseldorf-Patient: 14.3.18



Stimulation of 5 Million PBMC with peptides:



Testung after 10 days:

11

RT50 YV9 (A2): YQYMDDLV +++ Gag7-121: KELYPLASLRSLFGN + + LL10: LYPLASLRSL + + A24/B27 epitope YL9: YPLASLRSL - B7 epitope

RT50yV9

Gag-specific CTL lines contain the Delta32-CCR5-Deletion

12

1 2 3 4 6

• 1. B-cell wild type
• 2. Düsseldorf patient B-cell
• 3. DNA ladder
• 4. B-cell heterozygous
• 5. Düsseldorf patient Gag CTL
• 6. Negative control

5

Düsseldorf-Patient: 6.2.2019



Elispot with freshly isolated PBMC: 200 000 cells/ Well



37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV.

13

Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold

EBV

Düsseldorf-Patient: 3.4.2019



Elispot with freshly isolated PBMC: 200 000 cells/ Well



37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV.

14

Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Low, borderline response to flu and EBV peptides Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold

Flu EBV

Recognition of HIV-1-epitopes by peptide – stimulated CTL lines in ELISPOT assays

15

11/ 18 Stop of ART 11/ 17 Stop of immunosuppression 200 400 600 800 1000 1200 1400

28.10.2015 29.01.2016 22.07.2016 08.12.2017 14.03.2018 12.12.2018 06.02.2019 03.04.2019 Spot forming Units

RTYV9 gag07-21 Gag-YL9 Gag-LL10

Summary I:

 The donor developed HIV-1-specific CTL against three

functional important CTL epitopes in RT and Gag

 Despite tacrolimus therapy, CTL lines against RT YV9 and

GAG epitopes grew well after peptide stimulation

 These CTL were not detectable in ELISPOT assays with

freshly isolated PBMC presumably to the iatrogenic immunosuppression

16

Summary II: After Stopp of Tacrolimus in 2018:

 No detection of CTL effector cells using freshly isolated PBMC in g-IFN-

ELISPOT assays

 Good outgrowth of CTL after stimulation with peptides and IL2.  This may be due to

• Low frequency of effector CTL (<1:100 000, but RT YV9 frequency 1:2000)
• Presence of memory cells which have not seen virus for a while and thus need

costimulation in addition to the peptide.

 This is indicating that viral replication is absent or low below threshold of

immune activation.

 However, this cannot rule out small amounts of residual virus.

17

Summary III:

 CTL against these epitopes were not detected in the donor´s

PBMC.

 This indicates that the new donor developed an immune

response to HIV-1 surviving transplantation procedure despite strong immunosuppression

 HIV-1-specific CTL could help to decrease viral reservoirs:  Graft versus virus response could help in clearance of HIV.

18

Summary IV: after stopp of ART

 In the follow up after stopp of ART loss of recognition of

RTYV9-specific CTL

 Decrease of Gag-specific CTL  Potential reasons:

• anergy: not probable as no medical immunosuppression, good PHA-

stimulation

• CTL escape mutation: not probable as no viral replication
• lack of antigenic stimulation due to low viral burden: probable
• Gag versus RT: per virion much more Gag-protein than RT,

therefore, stronger stimulation by Gag

19

Acknowledgment

Christiane Mummert Silke Bergmann Björn Jensen Guido Kobbe Rolf Kaiser, Elena Knops, Eva Heger

20