switching on the power of e coli
play

SWITCHING)ON)THE) POWER)OF) E.#COLI# - PowerPoint PPT Presentation

Feb 13, 2024 •44 likes •524 views

SWITCHING)ON)THE) POWER)OF) E.#COLI# A"customisable"integrase"switch" Water"Purifica5on" Produc5on"of"clean"water"using"biological"processes"

  1. SWITCHING)ON)THE) POWER)OF) E.#COLI# A"customisable"integrase"switch"

  2. Water"Purifica5on" • Produc5on"of"clean"water"using"biological"processes" • Use"in"agriculture"and"industry" • Possible"source"of"drinking"water"

  3. Our"Mo5va5on" • Bacteria"have"been"engineered"to"uptake"or"produce" different"substances" • Removing"the"bacteria"from"the"liquid"is"challenging"

  4. The"Idea:"Inducing"Gas"Vesicles"

  5. How"Can"We"Induce"Them"To"Float?" • IntegraseIbased"inversion" switch" • Inheritable"and"inducible" switch"mechanism"" " • Enable"flota5on" " "

  6. What"Did"We"Do?" • Public"engagement " • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by"integrase" " "

  7. Glasgow"Science"Centre"2014" • Understanding"the"public’s"view"of"GM"organisms" • Helped"to"focus"the"direc5on"of"the"project" • Allowed"star5ng"point"from"which"to"contact"professionals"in"the"field" • Helped"to"introduce"synthe5c"biology"to"children"in"a"fun"way"

  8. Gate"1"–" Idea" Stage"1"–"Developing" the"Basics" Gate"2"–"Choosing" Applica5on" Stage"2"–"Developing"Final" Technology" Gate"3"–"Suitable"for" Industry?" Stage"3"–" Scaling"Up" Gate"4"–"Considering" the"Future" Industrial"Use"of" Product"

  9. Outreach"Results:"The"Public’s"View" Would"you"be"comfortable" "with"using"our"bacteriaItreated"water?"" n"="100"

  10. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  11. Bacteria"and"Buoyancy" ρ))=)250kg/ m 3)

  12. Run"and"Tumble" Based"on"a"Random"Walk" • Run"Time"="Exponen5al"Distribu5on:" • Mean:"1"second" • Tumble"angle"="Normal" Distribu5on:" • Mean"="68°" • Standard"Devia5on:"36°" ""

  13. Buoyancy"And"Run"And"Tumble" Results":"When"bacteria"swim,"buoyancy"is"not"a"significant"force"–" bacteria"do"not"‘float’."" Conclusion:"floa5ng"requires"knocking"out"swimming.""

  14. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  15. Mo5lity"Genes" • Poten5al"mo5lity"gene"candidates " " Modified"from"Reid"2006"

  16. MotA"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA"

  17. MotA"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA"

  18. RBS" ACCGAGGAAGCATGAGAATCAAG motB% M K N Q motA% T E E A * motA% motB% motA% motB% ery R"

  19. MotA/MotB"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA/MotB"

  20. MotA/MotB"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA/MotB"

  21. MotA/MotB"Gene"Rescue"of"KO"Strain"

  22. FliC"Gene"Rescue"of"KO"Strain" WildItype"DS941"" DS941"FliC"KO" DS941"FliC"KO"+"promoter/FliC"

  23. FliC"Gene"Rescue"of"KO"Strain" WildItype"DS941"" DS941"FliC"KO" DS941"FliC"KO"+"promoter/FliC"

  24. FliC"Gene"Rescue"of"KO"Strain" FliC"Mo5lity"Swarm"Assay"" 9" 8" 7" 6" Distance"(cm)" 5" 4" 3" 2" 1" 0" WT" FliC"KO" FliC"+"no"promoter" J23116"+"FliC" J23106"+"FliC"

  25. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  26. Floa5ng"Efficiency"Measurement"System" Based"on"light"scanering"by"bacteria."" 1. Power"supply" 2. Breadboard"with"2"LEDs" 3. Light"Blocker/Diffuser" Unit" 4. Cuvene"holder"unit" 5. Webcam" 6. Mouldable"Adhesive" (Blutac)" "

  27. Measurement"System:"Results" Average)Speed) TheoreKcal)at) [NaCl]) (μm/s)) 20°C)(μm/s)) 1M" 12.1" 12.0" 3M" 12.7" 9.0" 5M" 8.2" 6.1" 3" • Used"yellow" glass"" Height"(cm)" """""beads"(5μm)" " • Close"to" """"theore5cal" """"speeds"but:" """" Sample)size) was" limited"" 0"

  28. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  29. Gas"Vesicle"Genes" • GvpA"and"GvpC"from" Planktothrix%rubescens% • GvpA" ! Main"component"of"GV" ! Single"pep5de"wall % • GvpC" ! Strengthens"GvpA"wall" Walsby"1994"

  30. GVP"Construct" • We"added"ribosome"binding"sites"biobricks" to"exis5ng"gvpA"and"gvpC"biobricks" • We"then"made"a"composite"biobrick"with" gvpA"and"gvpC"together."" • We"put"these"under"the"control"of"an" arabinose"inducible"promoter"

  31. Gas"Vesicle"Protein"Expression" Arabinose"I" Arabinose"+" GVP"expression"appears"toxic"

  32. Gas"Vesicle"Protein"Expression" Arabinose"I" Arabinose"+" GVP"expression"appears"toxic"

  33. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  34. An"IntegraseIBased"Inversion"Switch" Viral"protein"for"genome"integra5on" " Binds"to" a5P "and" a5B% and % it"inverts"the"sequence"between"the"sites"

  35. An"IntegraseIBased"Inversion"Switch" Viral"protein"for"genome"integra5on" " Binds"to" a5P "and" a5B% and % it"inverts"the"sequence"between"the"sites" We"have"created"a"customisable"switch"biobrick"that"anyone"can"use"to"control" genes"of"their"choice.""

  36. Reverse"Ribosome"Binding"Site" Part)Number) Predicted)Binding)Strength)(au)) BBa_B0034) ~20,000" BBa_I742130) ~500" BBa_K1463560) ~12,000"

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional Office E. coli situation 13 wadeable streams with E. coli conc. in excess of criteria E. coli TMDLs Hauser Creek < cows

355 views • 16 slides
EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives

EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives

EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives (VFD), Fluorescent Ballasts, Power Supplies and Welders. These are all potential sources of interference on the power lines and can generate both

444 views • 40 slides
Switching in Pharmacy Practice What is Switching Switching is where a prescription that

Switching in Pharmacy Practice What is Switching Switching is where a prescription that

Switching in Pharmacy Practice What is Switching Switching is where a prescription that should be Non Levy has insufficient exemption endorsements made on the back, resulting in a default to levy status. T his means the NHS think we have

341 views • 8 slides
Integration of Routing and Switching Label Switching & IP switching The goal is to avoid

Integration of Routing and Switching Label Switching & IP switching The goal is to avoid

Integration of Routing and Switching Label Switching & IP switching The goal is to avoid executing packet forwarding algorithm for each and every packet and replace it with switching in hardware. The result is faster and less expensive IP

440 views • 23 slides
Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning

Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning

Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning March 20 th , 2019 Robust Simultaneous Switching Noise Prediction for Test using Deep Neural Network Seyed Nima Mozaffari, Bonita Bhaskaran,

969 views • 45 slides
Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on

Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on

Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on circuit or packet switching Circuit switching designed for voice Resources dedicated to a particular call Much of the time a data connection is

358 views • 14 slides
Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and

Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and

Introduction Switching Error-Correcting Codes Switching Switching Designs Switching Covering Codes Results Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and Networking Aalto University P.O. Box

406 views • 36 slides
Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases

Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases

Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases reported per year in Scotland Most patients recover within 10 days Symptoms bloody diarrhoea, abdominal cramps, fever and vomiting

447 views • 15 slides
Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching

Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching

Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching Class-D Configuration Yifei Li, Byron J. Montgomery and Nathan M. Neihart Iowa State University WAMICON 2016 Clearwater Beach, FL Contents

584 views • 21 slides
Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data

Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data

ITS323 Switching Switched Networks Circuit Switching Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data Communications Sirindhorn International Institute of Technology Thammasat University Prepared by

592 views • 30 slides
Switching Algebra Basic postulate: existence of two-valued switching variable that takes two

Switching Algebra Basic postulate: existence of two-valued switching variable that takes two

Switching Algebra and Its Applications 1 Zvi Kohavi and Niraj K. Jha Switching Algebra Basic postulate: existence of two-valued switching variable that takes two distinct values 0 and 1 Switching algebra: algebraic system of set {0,1}, binary

424 views • 18 slides
Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation

Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation

Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation + E.coli li li Prototype Mycobacterium Phage Bxb1, gp35(DNA integrase) & gp47(DNA excisionase) Target att B att P Mycobacterium Phage

1.07k views • 68 slides
Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E.

Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E.

Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E. coli Notifications Process Task Force Initiation/IMT initiation Operations Deactivation Shiga toxin E. Coli Epidemiology E. Coli

173 views • 13 slides
Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear

Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear

Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear supply (check Wiener crate as a noise source) Spectrum analyzer measurements Disabling ADC sampling on subset of channels, check noise on

181 views • 15 slides
Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331:

Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331:

ITS323/CSS331 Switching Switched Networks Circuit Switching Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331: Fundamentals of Data Communications Sirindhorn International Institute of Technology

687 views • 30 slides
1 Message Message Switching Switching Mail delivery G. Bianchi, G. Neglia Packet Switching

1 Message Message Switching Switching Mail delivery G. Bianchi, G. Neglia Packet Switching

432 views • 11 slides
Rotavirus Strain Surveillance in the Vaccine Era: Why should we characterize strains? Jon

Rotavirus Strain Surveillance in the Vaccine Era: Why should we characterize strains? Jon

Rotavirus Strain Surveillance in the Vaccine Era: Why should we characterize strains? Jon Gentsch, Carl Kirkwood, George Armah, Jim Gray, Miren Iturriza-Gomara, Nicola Page, Duncan Steele, Mathew Esona, May El Sherif and Roger Glass Centers

207 views • 20 slides
with HD Fiber Optic Sensing How Fiber Optic Sensing Enables the Acquisition of Critical Data

with HD Fiber Optic Sensing How Fiber Optic Sensing Enables the Acquisition of Critical Data

See What Youve Been Missing with HD Fiber Optic Sensing How Fiber Optic Sensing Enables the Acquisition of Critical Data Presenter Nick Scott B.S. Mechanical Engineering from Virginia Tech Luna Applications Engineer Supports: Project

603 views • 27 slides
Strain analysis of the Xuefengshan Belt, South China From internal strain variation to formation

Strain analysis of the Xuefengshan Belt, South China From internal strain variation to formation

Strain analysis of the Xuefengshan Belt, South China From internal strain variation to formation of the orogenic curvature Introduction: the concept Structures at multiple scales may reflect different information for quantification.

319 views • 17 slides
58:080 Final Projects Overview of Past Projects University of Iowa Propose and Plan Final

58:080 Final Projects Overview of Past Projects University of Iowa Propose and Plan Final

58:080 Final Projects Overview of Past Projects University of Iowa Propose and Plan Final Projects Experimental Test Plan (see textbook Chapter 1.3): devise a plan of attack for experiments in order that the information you need is

1.72k views • 158 slides
RESIDUAL STRAIN MEASUREMENT IN Presentation by: Jason Cantrell COMPOSITES USING CURE-

RESIDUAL STRAIN MEASUREMENT IN Presentation by: Jason Cantrell COMPOSITES USING CURE-

RESIDUAL STRAIN MEASUREMENT IN Presentation by: Jason Cantrell COMPOSITES USING CURE- COMPOSITES USING CURE EAS 6939 1/31/11 REFERENCING METHOD by: P.G Ifju, X. Niu, B.C Kilday, S.-C. Liu & S.M. Ettinger Background g Residual

419 views • 12 slides
Infant Bacterial Therapeutics Corporate Presentation March 2018 1 Disclaimer You must read the

Infant Bacterial Therapeutics Corporate Presentation March 2018 1 Disclaimer You must read the

Infant Bacterial Therapeutics Corporate Presentation March 2018 1 Disclaimer You must read the following before continuing. The following applies to this document and the information provided in this presentation by Infant Bacterial

603 views • 29 slides
Development of Integrated Screening, Cultivar Optimization, and Verification Research Michael

Development of Integrated Screening, Cultivar Optimization, and Verification Research Michael

Development of Integrated Screening, Cultivar Optimization, and Verification Research Michael Huesemann, Scott Edmundson, Song Gao Pacific Northwest National Laboratory Taraka Dale, Amanda Barry Los Alamos National Laboratory Lieve Laurens,

943 views • 50 slides
Why measure strain ? Strain coils Magnetic Coupling Transmitter Coil Oscillator Meter

Why measure strain ? Strain coils Magnetic Coupling Transmitter Coil Oscillator Meter

Why measure strain ? Strain coils Magnetic Coupling Transmitter Coil Oscillator Meter Receiver Coil Strain Coil setup in 3d Y X Transmitting coil Receiving coils Z Strain Coil 3d array stack Direction of travel 75 mm 75 mm At

367 views • 20 slides

More recommend