RNA Structures Stability, Folding and the Role of Hydrogen Bonding - PowerPoint PPT Presentation

RNA Structures Stability, Folding and the Role of Hydrogen Bonding and Protons Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien Schloß Ringberg, 05.03.2002

5' - end N 1 O The chemical formula of RNA CH 2 O consisting of nucleobases, ribose rings, phosphate groups, and sodium counterions N A U G C k = , , , OH O N 2 CH 2 O P O O Na � O O OH N 3 O P O CH 2 O Na � O O OH N 4 O P O CH 2 O Na � O O OH 3' - end O P O Na � O

Structural Constraints and Hydrogen Bonding in RNA Single stranded RNA molecules form structures, which combine double-helical stacking (A-type) regions with loops and metal ion (Mg 2 � ) coordinated centers.

The three-dimensional structure of a short double helical stack

Canonical Watson-Crick base pairs: cytosine – guanine uracil – adenine W.Saenger, Principles of Nucleic Acid Structure, Springer, Berlin 1984

O N H O G=U N N O H N N H H N N H O H N � G C N H N N O N O H N N U=G N H O H N O H N N N H N H Canonical Watson-Crick base-pair Wobble base-pairs Wobble base pairs in RNA double-helical stacks

2-amino,6-keto purine G 2-keto, 4-amino pyrimidine C ``A´´ 2,6-diamino purine 2,4-di keto pyrimidine U 2-keto, 6-amino purine 2- amino , 4- keto pyrimidine Color code: Donor—Acceptor 2,6-diketo purine Acceptor—Donor 2,6-diamin pyrimidine o 5-keto, 7-amino, 1,6,8-triaza indolicine 2- amino , 6-keto pyrazine 5- amino , 7- keto , Hydrogen bonding 1,6,8-triaza indolicine 2- keto , 6- amino pyrazine patterns for Watson- Crick base pairs S.A. Benner et al ., Reading the palimpsest: Contemporary biochemical data and the RNA world. In: R.F.Gesteland and J.F.Atkins, eds. The RNA World, pp.27-70. CSHL Press, 1993

Classification of purine- pyrimidine base pairs

Classification of purine-purine base pairs

Classification of pyrimidine- pyrimidine base pairs

General classification of base pairs N.B.Leontis and E. Westhof, RNA 7 :499-512 (2001)

Stacking of heterocyclic aromatic molecules without sugar-phosphate backbone Example: N6,N9-dimethyl adenine, D. Pörschke and F. Eggers, Eur.J.Biochem . 26 :490-498 (1972)

Stacking of RNA single strands Example: poly- A , D.Pörschke. Elementary steps of base recognition and helix-coil transitions in nucleic acids. In: I.Pecht and R.Rigler, eds. Chemical Relaxation in Molecular Biology, pp.191-218. Springer-Verlag, Berlin 1977.

Three-dimensional structure of phenylalanyl-transfer-RNA

RNA Secondary Structures and their Properties RNA secondary structures are listings of Watson-Crick and GU wobble base pairs, which are free of knots and pseudokots. Secondary structures are folding intermediates in the formation of full three-dimensional structures. D.Thirumalai, N.Lee, S.A.Woodson, and D.K.Klimov. Annu.Rev.Phys.Chem . 52 :751-762 (2001)

5'-End 3'-End Sequence GCGGAU UUA GCUC AGDDGGGA GAGC M CCAGA CUGAAYA UCUGG AGMUC CUGUG TPCGAUC CACAG A AUUCGC ACCA 3'-End 5'-End 70 60 Secondary Structure 10 50 20 30 40 Symbolic Notation 5'-End 3'-End Definition of the secondary structure of phenylalanyl-tRNA

� � � � T = 0 K , t T > 0 K , t T > 0 K , t finite 3.30 3.40 3.10 49 48 47 46 2.80 45 44 42 43 41 40 38 37 39 36 Free Energy 34 35 33 32 31 29 30 28 27 26 25 2.60 24 23 22 21 20 19 3.10 18 S 10 17 16 15 13 14 12 S 8 3.40 2.90 S 9 11 10 9 S 7 5.10 S 5 3.00 S 6 8 6 7 5 S 4 4 S 3 3 7.40 S 2 2 5.90 S 1 S 0 S 0 S 1 S 0 Minimum Free Energy Structure Suboptimal Structures Kinetic Structures Different notions of RNA structure

RNA Minimum Free Energy Structures Efficient algorithms based on dynamical programming are available for computation of secondary structures for given sequences. Inverse folding algorithms compute sequences for given secondary structures. M.Zuker and P.Stiegler. Nucleic Acids Res . 9 :133-148 (1981) Vienna RNA Package : http:www.tbi.univie.ac.at (includes inverse folding, suboptimal structures, kinetic folding, etc.) I.L.Hofacker, W. Fontana, P.F.Stadler, L.S.Bonhoeffer, M.Tacker, and P. Schuster. Mh.Chem . 125 :167-188 (1994)

Criterion of Minimum Free Energy UUUAGCCAGCGCGAGUCGUGCGGACGGGGUUAUCUCUGUCGGGCUAGGGCGC GUGAGCGCGGGGCACAGUUUCUCAAGGAUGUAAGUUUUUGCCGUUUAUCUGG UUAGCGAGAGAGGAGGCUUCUAGACCCAGCUCUCUGGGUCGUUGCUGAUGCG CAUUGGUGCUAAUGAUAUUAGGGCUGUAUUCCUGUAUAGCGAUCAGUGUCCG GUAGGCCCUCUUGACAUAAGAUUUUUCCAAUGGUGGGAGAUGGCCAUUGCAG Sequence Space Shape Space

ψ Sk = ( ) I. � G k = ( f S ) k Non-negative Sequence space Shape space numbers Mapping from sequence space into phenotype space and into free energies

.... GC CA UC .... d =1 H d =2 .... GC GA UC .... .... GC CU UC .... H d =1 H .... GC GU UC .... Point mutations as moves in sequence space

� � � � � -1 � � G = ( S ) | ( ) = I I S k k j j k � � (k) j / λ k = λ j = 12 27 , | G k | / κ - cr = 1 - -1 ( 1) λ κ Connectivity Threshold: � � � Alphabet Size : AUGC = 4 cr 2 0.5 λ λ Network is connected > G k cr . . . . k 3 0.4226 λ λ Network is not connected < cr . . . . G k 4 0.3700 k Mean degree of neutrality and connectivity of neutral networks

A connected neutral network

Giant Component A multi-component neutral network

Kinetic Folding of RNA at Elementary Step Resolution The RNA folding process is resolved to base pair closure , base pair cleavage and base pair shift . The kinetic folding behavior is determined by computation of a sufficiently large ensemble of individual folding trajectories and taking an average over them. The folding behavior is illustrated by barrier trees showing the path of lowest energy between two local minima of free energy. C.Flamm, W.Fontana, I.L.Hofacker and P.Schuster. RNA , 6 :325-338 (2000)

closure cleavage shift Move set for elementary steps in kinetic RNA folding

Folding dynamics of the sequence GGCCCCUUUGGGGGCCAGACCCCUAAAAAGGGUC

3’-end C U G G G A A A A A U C C C C A G A C C G G G G G U U U C C C C G G A A A C G A U C A G C Minimum free energy conformation S 0 G C G C Suboptimal conformation S 1 G C G C G C G C G C A U G U C G A U A U A G C One sequence is compatible with U A G C two structures C G C G C G C G C G C G C G C G G U U G G C U U

(h) S 5 (h) S 1 (h) S 2 (h) (h) � 0 S 9 S 7 Free energy G (h) S 6 Suboptimal conformations Search for local minima in conformation space S h Local minimum

Free energy G0 � Free energy G0 � T k � S � S � Saddle point T k � S k S k "Barrier tree" "Reaction coordinate"

3.30 3.40 3.10 49 48 47 46 2.80 45 44 42 43 41 40 38 39 37 36 34 35 33 32 29 31 30 28 27 25 2.60 26 24 23 22 21 20 19 3.10 18 17 16 15 13 14 12 3.40 2.90 11 10 9 5.10 3.00 8 7 6 5 4 3 7.40 2 Barrier tree of a sequence with 5.90 two conformations S 1 S 0

A ribozyme switch E.A.Schultes, D.B.Bartel, One sequence, two ribozymes: Implication for the emergence of new ribozyme folds . Science 289 (2000), 448-452

OH 5' 3' OH U A G C Cleavage site C G G C U A A C G G U C G C C OH 3' A G C ppp 5' C A G C G G A A G G C C C U C C G G A G G A A G U The "hammerhead" ribozyme The smallest known catalytically active RNA molecule

Two ribozymes of chain lengths n = 88 nucleotides: An artificial ligase ( A ) and a natural cleavage ribozyme of hepatitis- � -virus ( B )

The sequence at the intersection : An RNA molecules which is 88 nucleotides long and can form both structures

Reference for the definition of the intersection and the proof of the intersection theorem

Two neutral walks through sequence space with conservation of structure and catalytic activity

Sequence of mutants from the intersection to both reference ribozymes

Reference for postulation and in silico verification of neutral networks

Coworkers Walter Fontana , Santa Fe Institute, NM Christian Reidys, Christian Forst , Los Alamos National Laboratory, NM Peter Stadler , Ivo L.Hofacker, Christoph Flamm, Universität Wien, AT Bärbel Stadler, Ulrike Mückstein, Andreas Wernitznig , Stefanie Widder, Stefan Wuchty, Universität Wien, AT Ulrike Göbel, Walter Grüner, Stefan Kopp, Jaqueline Weber, Institut für Molekulare Biotechnologie, Jena, GE