More than 40 Years Research on (Bio)Polymers DNA the star among the - - PowerPoint PPT Presentation
More than 40 Years Research on (Bio)Polymers DNA the star among the biomolecules and RNA the magic molecule Peter Schuster Institut fr Theoretische Chemie, Universitt Wien, Austria and The Santa Fe Institute, Santa Fe, New
DNA the ‚star‘ among the biomolecules and RNA the ‚magic molecule‘ Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Central European Symposium for Theoretical Chemistry 2009 Dobogókő, 25.– 28.09.2009
Born June 02, 1929 in Budapest
Cited by 440 articles
Cited by 55 articles
Cited by 42 articles
Cooperativity in intermolecular forces
James D. Watson, 1928-, and Francis H.C. Crick, 1916-2004 Nobel prize 1962
1953 – 2003 fifty years double helix The three-dimensional structure of a short double helical stack of B-DNA
Modern phylogenetic tree: Lynn Margulis, Karlene V. Schwartz. Five Kingdoms. An Illustrated Guide to the Phyla of Life on Earth. W.H. Freeman, San Francisco, 1982.
The molecular clock of evolution
Motoo Kimura. The Neutral Theory of Molecular Evolution. Cambridge University Press. Cambridge, UK, 1983.
Point mutation
Reconstruction of phylogenies through comparison of molecular sequence data
A model for the genome duplication in yeast 100 million years ago
Manolis Kellis, Bruce W. Birren, and Eric S. Lander. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624, 2004
A model for the genome duplication in yeast 100 million years ago
Manolis Kellis, Bruce W. Birren, and Eric S. Lander. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624, 2004
A model for the genome duplication in yeast 100 million years ago
Manolis Kellis, Bruce W. Birren, and Eric S. Lander. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624, 2004
A model for the genome duplication in yeast 100 million years ago
Manolis Kellis, Bruce W. Birren, and Eric S. Lander. Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624, 2004
A sketch of a genetic and metabolic network
A B C D E F G H I J K L 1
2 3 4 5 6 7 8 9 10
The reaction network of cellular metabolism published by Boehringer-Ingelheim.
The citric acid
(enlarged from previous slide).
RNA as scaffold for supramolecular complexes
ribosome ? ? ? ? ?
RNA – The magic molecule
The world as a precursor of the current + biology RNA DNA protein
RNA as catalyst Ribozyme
RNA as carrier of genetic information
RNA viruses and retroviruses RNA evolution in vitro
N = 4n NS < 3n Criterion: Minimum free energy (mfe) Rules: _ ( _ ) _ {AU,CG,GC,GU,UA,UG} A symbolic notation of RNA secondary structure that is equivalent to the conventional graphs
RNA sequence RNA structure
energy
RNA folding: Structural biology, spectroscopy of biomolecules, understanding molecular function Empirical parameters Biophysical chemistry: thermodynamics and kinetics
Sequence, structure, and design Vienna RNA-Package
Version 1.8.3
http://www.tbi.univie.ac.at
Extension of the notion of structure
hairpin loop hairpin loop stack s t a c k stack hairpin loop stack free end free end free end hairpin loop hairpin loop stack stack free end free end joint hairpin loop stack stack stack internal loop bulge multiloop
Elements of RNA secondary structures as used in free energy calculations
loops internal bulges loops hairpin pairs base
stacks , 300
i b l kl ij
R.W. Hammond, R.A. Owens. Molecular Plant Pathology Laboratory, US Department of Agriculture
Plant damage by viroids
Nucleotide sequence and secondary structure
H.J.Gross, H. Domdey, C. Lossow, P Jank,
Nature 273:203-208 (1978)
Nucleotide sequence and secondary structure
H.J.Gross, H. Domdey, C. Lossow, P Jank,
Nature 273:203-208 (1978)
Vienna RNA Package 1.8.2 Biochemically supported structure
RNA sequence RNA structure
energy
Inverse folding of RNA: Biotechnology, design of biomolecules with predefined structures and functions RNA folding: Structural biology, spectroscopy of biomolecules, understanding molecular function Inverse Folding Algorithm Iterative determination
given secondary structure
Sequence, structure, and design Vienna RNA-Package
Version 1.8.3
http://www.tbi.univie.ac.at
Inverse folding algorithm I0 I1 I2 I3 I4 ... Ik Ik+1 ... It S0 S1 S2 S3 S4 ... Sk Sk+1 ... St Ik+1 = Mk(Ik) and dS(Sk,Sk+1) = dS(Sk+1,St) - dS(Sk,St) < 0 M ... base or base pair mutation operator dS (Si,Sj) ... distance between the two structures Si and Sj ‚Unsuccessful trial‘ ... termination after n steps
Target structure Sk
Initial trial sequences Target sequence Stop sequence of an unsuccessful trial Intermediate compatible sequences Intermediate compatible sequences
Approach to the target structure Sk in the inverse folding algorithm
The inverse folding algorithm searches for sequences that form a given RNA secondary structure under the minimum free energy criterion.
k j j k
j k Space of genotypes: = { I
1 2 3 4 N 1 2 3 4 M
many genotypes
An example of ‘artificial selection’ with RNA molecules or ‘breeding’ of biomolecules
tobramycin RNA aptamer, n = 27
Formation of secondary structure of the tobramycin binding RNA aptamer with KD = 9 nM
RNA aptamer complex. Chemistry & Biology 4:35-50 (1997)
The three-dimensional structure of the tobramycin aptamer complex
Chemistry & Biology 4:35-50 (1997)
RNA 9:1456-1463, 2003
Evidence for neutral networks and shape space covering
Evidence for neutral networks and
intersection of apatamer functions
Extension of the notion of structure
GCGUCGCGUGCCAUGGAGCAUCAUUACAUGAGACAGCCCCGGCCUCGGAU
(((((.((((..(((......)))..)))).))).)).(((....))).. -12.20 (((((.((((..((((....))))..)))).))).)).(((....))).. -12.10 ..(((.((.(((..((.((.((((...))))....)))).)))..))))) -11.50 ..(((.((((..(((......)))..)))).)))....(((....))).. -11.40 ..(((.((((..((((....))))..)))).)))....(((....))).. -11.30 ..(((.((.(((..((.((.(((.....)))....)))).)))..))))) -11.30 ..(((.((.(((..((.((.((((...))))....)).)))))..))))) -11.10 ...(((.(.(((..((.((.((((...))))....)))).)))).))).. -11.10 ..(((.((.(((..((.((.(((.....)))....)).)))))..))))) -10.90 ...(((.(.(((..((.((.(((.....)))....)))).)))).))).. -10.90 (((((.((((..(((......)))..)))).))).)).((......)).. -10.80 (((((.((((..((((....))))..)))).))).)).((......)).. -10.70 ...(((.(.(((..((.((.((((...))))....)).)))))).))).. -10.70 ..(((.((.(((..((....((((...)))).....))..)))..))))) -10.60 ...((.((.(((..((.((.((((...))))....)))).)))..)))). -10.60 ...(((.(.(((..((.((.(((.....)))....)).)))))).))).. -10.50 ....((.(.(((..((.((.((((...))))....)))).)))).))... -10.50 ..(((.((((..(((......)))..)))).))).((....))....... -10.40 ..(((.((.(((..((.((.((.......))....)))).)))..))))) -10.40 ..(((.((.(((..((....(((.....))).....))..)))..))))) -10.40 ...((.((.(((..((.((.(((.....)))....)))).)))..)))). -10.40 (((((.((((...((......))...)))).))).)).(((....))).. -10.30 ..(((.((((..((((....))))..)))).))).((....))....... -10.30 ....((.(.(((..((.((.(((.....)))....)))).)))).))... -10.30 (((((.((((...(((....)))...)))).))).)).(((....))).. -10.20 ...(((.(.(((..((....((((...)))).....))..)))).))).. -10.20 ...((.((.(((..((.((.((((...))))....)).)))))..)))). -10.20 ............................. ............................. .............................
GCGGAGUCUUUUUGCGGCCGAGCACUAGGAAUCCAGCCGUGGUACCACUU CCGGUUCUUUAGUCUGGCAGAGGAGGAAGGUGCCAGGUGCAACUCUGCGU
Two neutral sequences with very different contributions of suboptimal conformations
Extension of the notion of structure
The Folding Algorithm
A sequence I specifies an energy ordered set of compatible structures S(I):
S(I) = {S0 , S1 , … , Sm , O}
A trajectory Tk(I) is a time ordered series of structures in S(I). A folding trajectory is defined by starting with the open chain O and ending with the global minimum free energy structure S0 or a metastable structure Sk which represents a local energy minimum:
T0(I) = {O , S (1) , … , S (t-1) , S (t) , S (t+1) , … , S0} Tk(I) = {O , S (1) , … , S (t-1) , S (t) , S (t+1) , … , Sk}
Master equation
( )
1 , , 1 , ) ( ) (
1 1 1
+ = − = − =
+ = + = + =
m k k P P k t P t P dt dP
m i ki k i m i ik m i ki ik k
K
Transition probabilities Pij(t) = Prob{Si→Sj} are defined by
Pij(t) = Pi(t) kij = Pi(t) exp(-∆Gij/2RT) / Σi Pji(t) = Pj(t) kji = Pj(t) exp(-∆Gji/2RT) / Σj exp(-∆Gki/2RT)
The symmetric rule for transition rate parameters is due to Kawasaki (K. Kawasaki, Diffusion constants near the critical point for time dependent Ising models. Phys.Rev. 145:224-230, 1966).
+ ≠ =
2 , 1 m i k k k
Formulation of kinetic RNA folding as a stochastic process
F r e e e n e r g y G
Sk S{ Saddle point T
{ k
F r e e e n e r g y G
S{ T
{ k
"Barrier tree"
Definition of a ‚barrier tree‘
JN1LH
1D 1D 1D 2D 2D 2D R R R
G GGGUGGAAC GUUC GAAC GUUCCUCCC CACGAG CACGAG CACGAG
G/
G G G G G G C C C C C C A A U U U U G G C C U U A A G G G C C C A A A A G C G C A A G C /G
G G G G G G GG CCC C C C C C U G G G G C C C C A A A A A A A A U U U U U G G C C A A
3 3 3 13 13 13 23 23 23 33 33 33 44 44 44
5' 5' 3’ 3’
J.H.A. Nagel, C. Flamm, I.L. Hofacker, K. Franke, M.H. de Smit, P. Schuster, and C.W.A. Pleij. Structural parameters affecting the kinetic competition of RNA hairpin formation. Nucleic Acids Res. 34:3568-3576 (2006)
An experimental RNA switch
4 5 8 9 11
1 9 2 2 4 2 5 2 7 3 3 3 4
36
38 39 41 46 47
3
49
1
2 6 7 10
1 2 1 3 1 4 1 5 1 6 1 7 1 8 2 1 22 2 3 2 6 2 8 2 9 3 3 1 32 3 5 3 7
40
4 2 4 3 44 45 48 50
2.77 5.32 2 . 9 3.4 2.36 2 . 4 4 2.44 2.44 1.46 1.44 1.66
1.9
2.14
2.51 2.14 2.51
2 . 1 4 1 . 4 7
1.49
3.04 2.97 3.04 4.88 6.13 6 . 8 2.89
Free energy [kcal / mole]
J1LH barrier tree
A ribozyme switch
E.A.Schultes, D.B.Bartel, Science 289 (2000), 448-452
Two ribozymes of chain lengths n = 88 nucleotides: An artificial ligase (A) and a natural cleavage ribozyme of hepatitis--virus (B)
The sequence at the intersection: An RNA molecules which is 88 nucleotides long and can form both structures
Two neutral walks through sequence space with conservation of structure and catalytic activity
The thiamine-pyrophosphate riboswitch
Science 312:1208-1211, 2006.
The thiamine-pyrophosphate riboswitch
W.C. Winkler, R.R, Breaker. Cell 113:577-586 (2003)
ENCODE Project Consortium. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447:799-816, 2007
ENCODE stands for ENCyclopedia Of DNA Elements.
Peter Stadler, Bärbel M. Stadler, Universität Leipzig, GE Paul E. Phillipson, University of Colorado at Boulder, CO Heinz Engl, Philipp Kügler, James Lu, Stefan Müller, RICAM Linz, AT Jord Nagel, Kees Pleij, Universiteit Leiden, NL Walter Fontana, Harvard Medical School, MA Christian Reidys, Christian Forst, Los Alamos National Laboratory, NM Ulrike Göbel, Walter Grüner, Stefan Kopp, Jaqueline Weber, Institut für Molekulare Biotechnologie, Jena, GE Ivo L.Hofacker, Christoph Flamm, Andreas Svrček-Seiler, Universität Wien, AT Kurt Grünberger, Michael Kospach , Andreas Wernitznig, Stefanie Widder, Stefan Wuchty, Andreas De Stefani, Universität Wien, AT Jan Cupal, Stefan Bernhart, Lukas Endler, Ulrike Langhammer, Rainer Machne, Ulrike Mückstein, Hakim Tafer, Thomas Taylor, Universität Wien, AT
Universität Wien