Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of - - PowerPoint PPT Presentation

Lecture 2: Biology Basics Continued

Central Dogma

DNA: The Code of Life

• The structure and the four genomic letters code for

all living organisms

• Adenine, Guanine, Thymine, and Cytosine which pair

A-T and C-G on complimentary strands.

• DNA has a double helix

structure which composed of

– sugar molecule – phosphate group – and a base (A,C,G,T)

• DNA always reads from

5’ end to 3’ end for transcription replication

DNA: The Code of Life

DNA Replication

• DNA can replicate by

splitting, and rebuilding each strand.

• Note that the rebuilding
• f each strand uses

slightly different mechanisms due to the 5’ 3’ asymmetry, but each daughter strand is an exact replica of the

• riginal strand.

http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/D/DNAReplication.html

Inverse Complement of DNA

What is the inverse complement sequence of TATAGCCCG?

Inverse Complement of DNA

What is the inverse complement sequence of TATAGCCCG? CGGGCTATA

Genotype/Phenotype

• To prevent confusion between genes (which

are inherited) and developmental outcomes (which are not), geneticists make a distinction between the genotype and the phenotype of an organism

– Genotype: complete set of genes inherited by an individual – Phenotype: all aspects of the individual’s physiology, behavior, and ecological relationships

DNA the Genetics Makeup

• Genes are inherited and

are expressed

• genotype (genetic

makeup)

• phenotype (physical

expression)

On the left, is the eye’s phenotypes of green and black eye genes.

• Two organisms whose genes differ at one

locus are said to have different genotypes.

• A locus (loci for plural) is the specific location
• f a gene of a DNA sequence on a

chromosome.

• A variant of the DNA sequence at a given

location is called a allele.

• The ordered list of loci known for a particular

genome is called a genetic map.

Diploid and polyploid cells whose chromosomes have the same allele of a given gene at some locus are called homozygous, with respect to that gene (otherwise, it is heterzygous). The chromosomal locus of a gene might be written "6p21.3”

• 6: chromosome number
• p: position on the

chromosome’s short arm (“p”) or long arm (“q”)

• 21.3: the position on the

arm: region 2, band 1, sub- band 3. The bands are visible under a microscope when the chromosome is stained.

Genotype/Phenotype

Phenotype: Blue eyes Brown eyes Genotype: Recessive: bb Dominant: Bb or BB

• Pleiotropy: when one gene affects many

different traits.

• Polygenic traits: when one trait is governed by

multiple genes, which maybe on the same chromosome or on different chromosomes.

– The additive effects of numerous genes on a single phenotype create a continuum of possible

• utcomes.

– Polygenic traits are also most susceptible to environmental influences.

Pleiotropy in humans: Phenylketonuria

A disorder that is caused by a deficiency of the enzyme phenylalanine hydroxylase, which is necessary to convert the essential amino acid phenylalanine to tyrosine. A defect in the single gene that codes for this enzyme therefore results in the multiple phenotypes associated with PKU, including mental retardation, eczema, and pigment defects that make affected individuals lighter skinned

Polygenic Inheritance in Humans

• Height is controlled by polygenes for skeleton height, but their

effect may be affected by malnutrition, injury, and disease.

• Weight, skin color, and intelligence.
• Birth defects like clubfoot, cleft palate, or neural tube defects are

also the result of multiple gene interactions.

• Complex diseases and traits have a tendency to have low

heritability (tendency to be inherited) compared to single gene disorders (i.e. sickle-cell anemia, cystic fibrosis, PKU, Hemophelia, many extremely rare genetic disorders).

Selection

• Some genes may be subject to selection, where

individuals with advantages or “adaptive” traits tend to be more successful than their peers reproductively

• When these traits have a genetic basis, selection

can increase the prevalence of those traits, because the offspring will inherit those traits. This may correlate with the organism's ability to survive in its environment.

• Several different genotypes (and possibly

phenotypes) may then coexist in a population. In this case, their genetic differences are called polymorphisms.

Genetic Mutation

• The simplest is the point mutation or substitution; here, a single

nucleotide in the genome is changed (single nucleotide polymorphisms (SNPs))

• Other types of mutations include the following:

– Insertion. A piece of DNA is inserted into the genome at a certain position – Deletion. A piece of DNA is cut from the genome at a certain position – Inversion. A piece of DNA is cut, flipped around and then re- inserted, thereby converting it into its complement – Translocation. A piece of DNA is moved to a different position. – Duplication. A copy of a piece of DNA is inserted into the genome

Mutations and Selection

• While mutations can be detrimental to the

affected individual, they can also in rare cases be beneficial; more frequently, neutral.

• Often mutations have no or a negligible impact
• n survival and reproduction.
• Thereby mutations can increase the genetic

diversity of a population, that is, the number of present polymorphisms.

• In combination with selection, this allow a

species to adapt to changing environmental conditions and to survive in the long term.

Raw Sequence Data

• 4 bases: A, C, G, T + other (i.e. N = any, R = G or A

(purine), Y = T or (pyrimidine))

– kb (= kbp) = kilo base pairs = 1,000 bp – Mb = mega base pairs = 1,000,000 bp – Gb = giga base pairs = 1,000,000,000 bp.

• Size:

– E. Coli 4.6Mbp (4,600,000) – Fish 130 Gbp (130,000,000,000) – Paris japonica (Plant) 150 Gbp – Human 3.2Gbp

Fasta File

• A sequence in FASTA format begins with a single-line

description, followed by lines of sequence data (file extension is .fa).

• It is recommended that all lines of text be shorter than 80

characters in length.

Fastq File

• Typically contain 4 lines:

– Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description. – Line 2 is the sequence. – Line 3 is the delimiter ‘+’, with an optional description. – Line 4 is the quality score. – file extension is .fq

@SEQ_ID GATTTGGGGTTCAAAGCTTCAAAGCTTCAAAGC + !''*((((***+))%%%++++++++!!!++***

Genes and Proteins

• One gene encodes one protein and begins with

start codon (e.g. ATG), then each three code one amino acid. Then a stop codon (e.g. TGA) signifies end of the gene.

• In the middle of a (eukaryotic) gene, there are

segments that are spliced out during transcription.

– Introns: segments that are spliced out – Exons: segments that are kept.

• Detecting the introns and exons is a task for gene

finding.

Genomics:

• Assembly
• Detection of variation
• GWAS

RNA:

• Gene expression
• Transcriptome assembly
• Pathway analysis

Protein:

• Mass spectrometry
• Structure prediction
• Protein-Protein

interaction