Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of - - PowerPoint PPT Presentation
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of - - PowerPoint PPT Presentation
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and C-G on complimentary strands.
Central Dogma
DNA: The Code of Life
- The structure and the four genomic letters code for
all living organisms
- Adenine, Guanine, Thymine, and Cytosine which pair
A-T and C-G on complimentary strands.
- DNA has a double helix
structure which composed of
– sugar molecule – phosphate group – and a base (A,C,G,T)
- DNA always reads from
5’ end to 3’ end for transcription replication
DNA: The Code of Life
DNA Replication
- DNA can replicate by
splitting, and rebuilding each strand.
- Note that the rebuilding
- f each strand uses
slightly different mechanisms due to the 5’ 3’ asymmetry, but each daughter strand is an exact replica of the
- riginal strand.
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/D/DNAReplication.html
Inverse Complement of DNA
What is the inverse complement sequence of TATAGCCCG?
Inverse Complement of DNA
What is the inverse complement sequence of TATAGCCCG? CGGGCTATA
Genotype/Phenotype
- To prevent confusion between genes (which
are inherited) and developmental outcomes (which are not), geneticists make a distinction between the genotype and the phenotype of an organism
– Genotype: complete set of genes inherited by an individual – Phenotype: all aspects of the individual’s physiology, behavior, and ecological relationships
DNA the Genetics Makeup
- Genes are inherited and
are expressed
- genotype (genetic
makeup)
- phenotype (physical
expression)
On the left, is the eye’s phenotypes of green and black eye genes.
- Two organisms whose genes differ at one
locus are said to have different genotypes.
- A locus (loci for plural) is the specific location
- f a gene of a DNA sequence on a
chromosome.
- A variant of the DNA sequence at a given
location is called a allele.
- The ordered list of loci known for a particular
genome is called a genetic map.
Diploid and polyploid cells whose chromosomes have the same allele of a given gene at some locus are called homozygous, with respect to that gene (otherwise, it is heterzygous). The chromosomal locus of a gene might be written "6p21.3”
- 6: chromosome number
- p: position on the
chromosome’s short arm (“p”) or long arm (“q”)
- 21.3: the position on the
arm: region 2, band 1, sub- band 3. The bands are visible under a microscope when the chromosome is stained.
Genotype/Phenotype
Phenotype: Blue eyes Brown eyes Genotype: Recessive: bb Dominant: Bb or BB
- Pleiotropy: when one gene affects many
different traits.
- Polygenic traits: when one trait is governed by
multiple genes, which maybe on the same chromosome or on different chromosomes.
– The additive effects of numerous genes on a single phenotype create a continuum of possible
- utcomes.
– Polygenic traits are also most susceptible to environmental influences.
Pleiotropy in humans: Phenylketonuria
A disorder that is caused by a deficiency of the enzyme phenylalanine hydroxylase, which is necessary to convert the essential amino acid phenylalanine to tyrosine. A defect in the single gene that codes for this enzyme therefore results in the multiple phenotypes associated with PKU, including mental retardation, eczema, and pigment defects that make affected individuals lighter skinned
Polygenic Inheritance in Humans
- Height is controlled by polygenes for skeleton height, but their
effect may be affected by malnutrition, injury, and disease.
- Weight, skin color, and intelligence.
- Birth defects like clubfoot, cleft palate, or neural tube defects are
also the result of multiple gene interactions.
- Complex diseases and traits have a tendency to have low
heritability (tendency to be inherited) compared to single gene disorders (i.e. sickle-cell anemia, cystic fibrosis, PKU, Hemophelia, many extremely rare genetic disorders).
Selection
- Some genes may be subject to selection, where
individuals with advantages or “adaptive” traits tend to be more successful than their peers reproductively
- When these traits have a genetic basis, selection
can increase the prevalence of those traits, because the offspring will inherit those traits. This may correlate with the organism's ability to survive in its environment.
- Several different genotypes (and possibly
phenotypes) may then coexist in a population. In this case, their genetic differences are called polymorphisms.
Genetic Mutation
- The simplest is the point mutation or substitution; here, a single
nucleotide in the genome is changed (single nucleotide polymorphisms (SNPs))
- Other types of mutations include the following:
– Insertion. A piece of DNA is inserted into the genome at a certain position – Deletion. A piece of DNA is cut from the genome at a certain position – Inversion. A piece of DNA is cut, flipped around and then re- inserted, thereby converting it into its complement – Translocation. A piece of DNA is moved to a different position. – Duplication. A copy of a piece of DNA is inserted into the genome
Mutations and Selection
- While mutations can be detrimental to the
affected individual, they can also in rare cases be beneficial; more frequently, neutral.
- Often mutations have no or a negligible impact
- n survival and reproduction.
- Thereby mutations can increase the genetic
diversity of a population, that is, the number of present polymorphisms.
- In combination with selection, this allow a
species to adapt to changing environmental conditions and to survive in the long term.
Raw Sequence Data
- 4 bases: A, C, G, T + other (i.e. N = any, R = G or A
(purine), Y = T or (pyrimidine))
– kb (= kbp) = kilo base pairs = 1,000 bp – Mb = mega base pairs = 1,000,000 bp – Gb = giga base pairs = 1,000,000,000 bp.
- Size:
– E. Coli 4.6Mbp (4,600,000) – Fish 130 Gbp (130,000,000,000) – Paris japonica (Plant) 150 Gbp – Human 3.2Gbp
Fasta File
- A sequence in FASTA format begins with a single-line
description, followed by lines of sequence data (file extension is .fa).
- It is recommended that all lines of text be shorter than 80
characters in length.
Fastq File
- Typically contain 4 lines:
– Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description. – Line 2 is the sequence. – Line 3 is the delimiter ‘+’, with an optional description. – Line 4 is the quality score. – file extension is .fq
@SEQ_ID GATTTGGGGTTCAAAGCTTCAAAGCTTCAAAGC + !''*((((***+))%%%++++++++!!!++***
Genes and Proteins
- One gene encodes one protein and begins with
start codon (e.g. ATG), then each three code one amino acid. Then a stop codon (e.g. TGA) signifies end of the gene.
- In the middle of a (eukaryotic) gene, there are
segments that are spliced out during transcription.
– Introns: segments that are spliced out – Exons: segments that are kept.
- Detecting the introns and exons is a task for gene
finding.
Genomics:
- Assembly
- Detection of variation
- GWAS
RNA:
- Gene expression
- Transcriptome assembly
- Pathway analysis
Protein:
- Mass spectrometry
- Structure prediction
- Protein-Protein
interaction