INODIFTAGENE Recombinant DNA Gene Therapy for Bladder Cancer July 2018 | 1
Safe Harbor Statement This presentation contains forward-looking statements within the meaning of U.S. federal securities laws and Israeli securities laws that involve risks and uncertainties. These forward-looking statements include, but are not limited to, statements about our market opportunities, our strategy, our competition, the further development and potential safety and efficacy of our product candidates, our projected revenue and expense levels and the adequacy of our available cash resources. Some of the information contained herein is based upon or derived from information provided by third-party consultants and other industry sources. We have not independently verified and cannot assure the accuracy of any data obtained by or from these sources. Drug discovery and development involve a high degree of risk. Factors that might cause material differences between expected and actual results include, among others, risks relating to: the successful preclinical development of our product candidates; the completion of clinical trials; the successful completion of the regulatory process with the FDA and other regula tory bodies, including the FDA’s review of any filings we make in connection with treatment protocols; uncertainties related to the ability to attract and retain partners for our technologies and products under development; infringement of our intellectual property; market penetration of competing products; raising sufficient funds needed to support our research and development efforts, and other factors described in our Israeli public filings. Although we believe that the expectations reflected in these forward-looking statements are based upon reasonable assumptions, no assurance can be given that such expectations will be attained or that any deviations will not be material. No reliance may be placed for any purpose whatsoever on the information contained in this presentation or on its completeness. No representation or warranty, express or implied, is given by us or on our behalf and/or our subsidiaries or any of our directors, officers or employees or any other person as to the accuracy or completeness of the information or opinions contained in this presentation. Neither we nor any of our subsidiaries, directors, officers, employees or any other person accepts any liability, whatsoever, for any loss howsoever arising, directly or indirectly, from any use of such information or opinions or otherwise arising in connection therewith. This presentation does not constitute or form part of, and should not be construed as constituting or forming part of, any offer or invitation to sell or issue, or any solicitation of any offer to purchase or subscribe for, any of our shares, nor shall any part of this presentation nor the fact of its distribution form part of or be relied on in connection with any contract or investment decision relating thereto, nor does it constitute a recommendation regarding our securities. July 2018 | 2
Investment Highlights Over $1.5 billion commercial potential Potential for first-of-its-kind DNA-directed serving large global population in need of cancer therapy in non-muscle invasive new therapy and uniquely addressing bladder cancer (NMIBC), a serious area of unmet need — inodiftagene vixteplasmid second line treatment Two registrational studies, providing Private financing closed in June; plan for independent routes to approval in two US IPO later in 2018 separate, but related, indications Preliminary data from development program Strong, experienced management team and FDA agreement support direct path to and newly expanding global organization approval with either of two trials July 2018 | 3
Inodiftagene for Non-Muscle Invasive Bladder Cancer INODIFTAGENE First-in-class, DNA-directed gene therapy moving into registrational development in early stage bladder cancer Initiating 2 pivotal trials, each of which could lead to approval Potential market of Data from phase 2 clinical trials show complete responses indicating strong efficacy $1.5 billion Non-Muscle Invasive Bladder Cancer (NMIBC) A large and underserved population $1.5 billion commercial global opportunity Current standard-of-care is a therapy introduced in the 1970s; patients who relapse go on to radical surgery or distant metastasis July 2018 | 4
Inodiftagene Clinical Development Program Five completed clinical trials in NMIBC, pancreatic and ovarian cancer PRODUCT INDICATION TRIAL NMIBC Phase 1/2 Responses in all three NMIBC Phase 2 cancer types in various Inodiftagene monotherapy NMIBC third line Pivotal Codex trial initiated clinical settings Pancreatic Cancer Phase 1/2 Focus on NMIBC for pivotal development Ovarian Cancer Phase 1/2 Inodiftagene NMIBC Phase 2 in combination with Bacillus Calmette Guerin NMIBC second line Pivotal Leo trial planned July 2018 | 5
Non-Muscle Invasive Bladder Cancer: NMIBC NMIBC is a common cancer in need of new therapies 5TH 4TH MOST COMMON CANCER MOST COMMON CANCER IN OVERALL IN EU MALES BEHIND ONLY LUNG, COLON, PROSTATE EU and Worldwide 2 In the United States 1 141,000 403,000 81,000 708,000 WORLDWIDE NEW NEW CASES IN PREVALENT EU NEW CASES/YEAR 2018 CASES IN 2018 CASES IN 2020 Quality of Life Issues No New Drugs in 20 Years Repeated recurrence 0 Repeated cystoscopy, surgery and drug treatment cycles Lifelong cystoscopy follow-up Most expensive cancer to treat Drugs approved by FDA since 1998 for NMIBC 1. ACS Cancer Facts and Figures 2018, www.cancer.org July 2018 | 6 2. https://ec.europa.eu/jrc/en/publication/epidemiology-bladder-cancer-europe
NMIBC Classification and Treatment Recurrence leads to progression and metastasis TUMOR DIAGNOSIS LOCALIZATION THERAPY Patients are diagnosed and evaluated Tumors are identified on the inner surface NMIBC patients initially receive Bacillus via cystoscope of the bladder, resected and classified by Calmette Guerin (BCG) and are the focus of depth inodiftagene therapy Sources: Knowles MA and CD Hurst, 2015. Nature Rev Cancer , 15: 25-41, Link. : NCCN Bladder Cancer Guidelines, v. 1.2017. July 2018 | 7
NMIBC Classification and Treatment Standard Care Recurrence is a life-changing outcome Treatment for NMIBC is trans-urethral resection, or TUR (surgery by cystoscope) to remove the small tumors, then therapy with BCG administered into the bladder. BCG is live attenuated TUR BCG 1L tuberculosis bacteria Recurrence BCG is recommended for initial therapy after TUR, then again TUR BCG 2L after first recurrence 70% of patients’ tumors ultimately fail BCG treatment, Recurrence necessitating radical cystectomy , which is a life changing Radical Cystectomy surgical procedure Sources: Knowles MA and CD Hurst, 2015. Nature Rev Cancer , 15: 25-41, Link. : NCCN Bladder Cancer July 2018 | 8 Guidelines, v. 1.2017.
Two Unmet Needs in NMIBC Therapy Inodiftagene addresses both NMIBC TUR 1 st TUR 2 nd Radical Diagnosis then BCG recurrence then BCG recurrence cystectomy Second-line need Third-line need New drug vs second BCG treatment New drug vs surgery Patients whose tumors recur after BCG therapy are those who need inodiftagene : the goal is to prevent or delay recurrence and cystectomy July 2018 | 9
Over 270,000 NMIBC Patients Are Eligible for Treatment Annually NMIBC market 260,000 ~75% Number of incident bladder cancer cases in Proportion of bladder cancer that is 2017 in US, EU, and Japan NMIBC. 187,000 cases ~70% 272,000 Proportion of NMIBC patients who suffer Total number of incident and recurrent NMIBC recurrence after BCG treatment. 85,000 cases who are eligible for treatment annually Of these 60,000 recurrent NMIBC cases after BCG treatment are eligible for inodiftagene treatment as second- or third-line therapy Sources: Decision Resources July 2018 | 10
First-in-Class, First-of-its-Kind Treatment Inodiftagene vixteplasmid gene therapy Targeted gene therapy Inodiftagene is a recombinant DNA molecule containing regulatory sequences from the H19 gene driving expression of diphtheria toxin A chain gene only in malignant cells H19 gene regulatory sequences: Diphtheria toxin A chain cancer specific gene: lethal in all cells GTCTCGCGGTCAGATCGCTAAGCTCGTCGCGAAGCTGCGTTTCAGATTTGATAGGCCTAGCTCGATTACGCG Transcription and expression Diphtheria toxin gene: efficient delivery Plasmid facilitates high transfection efficiency. In vitro uptake in 85% of cells after a single exposure; in clinic detectable in bladder more than 48 hours after instillation. Engineered to prevent transfer of toxin between cells Well-understood mechanism-of-action July 2018 | 11
Recommend
More recommend
