Genome Sequencing (Part 1) Lecture 4: August 30, 2012 - - PowerPoint PPT Presentation

Genome ¡Sequencing ¡(Part ¡1) ¡

Lecture ¡4: ¡August ¡30, ¡2012 ¡

¡

Review ¡from ¡Last ¡Lecture ¡

De ¡novo ¡vs. ¡Re-­‑sequencing ¡

• De ¡novo ¡assembly ¡(“from ¡the ¡beginning”) ¡

implies ¡that ¡you ¡have ¡no ¡prior ¡knowledge ¡of ¡ the ¡genome. ¡ ¡No ¡reference, ¡no ¡conNgs, ¡only ¡

• reads. ¡
• Re-­‑sequencing ¡assembly ¡assumes ¡you ¡have ¡a ¡

copy ¡of ¡the ¡reference ¡genome ¡(that ¡has ¡been ¡ verified ¡to ¡a ¡certain ¡degree). ¡

• The ¡programs ¡that ¡work ¡for ¡re-­‑sequencing ¡will ¡

not ¡work ¡for ¡de ¡novo ¡and ¡vice ¡versa. ¡However, ¡ both ¡can ¡create ¡copies ¡of ¡the ¡genome. ¡

De ¡novo ¡vs. ¡Re-­‑sequencing ¡

Sample ¡PreparaNon ¡

Fragments

Re-sequencing (LOCAS, Shrimp) requires 15x to 30x coverage. Anything less and re-sequencing programs will not produce results or produce questionable results.

Sample ¡PreparaNon ¡

Fragments

De-novo assembly requires higher

• coverage. At least 30x but upwards to

100x’s coverage. Most de novo assemblers require paired-end data.

IntroducNon ¡and ¡History ¡

Sample ¡PreparaNon ¡

Sample ¡PreparaNon ¡

Fragments ¡

Sample ¡PreparaNon ¡ Sequencing ¡

ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAA

Reads ¡ Fragments ¡ Next ¡GeneraNon ¡Sequencing ¡(NGS) ¡

Sample ¡PreparaNon ¡ Sequencing ¡ Assembly ¡

ACGTAGAATACGTAGAAACAGATTAGAGAG…

ConNgs ¡ Fragments ¡ Reads ¡

ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAA

Sample ¡PreparaNon ¡ Sequencing ¡ Assembly ¡ Analysis ¡

Fragments ¡ Reads ¡ ConNgs ¡

Sample ¡PreparaNon ¡ Sequencing ¡ Assembly ¡ Analysis ¡

Fragments ¡ Reads ¡ ConNgs ¡ Our ¡focus ¡for ¡today’s ¡lecture: ¡

• 1. Comparison ¡of ¡sequencing ¡

plaXorms ¡

• 2. Details ¡of ¡sample ¡preparaNon ¡
• 3. DefiniNons ¡and ¡terminologies ¡

concerning ¡data ¡and ¡ sequencing ¡plaXorms ¡

Landmarks ¡in ¡Sequencing ¡

Efficiency ¡ ¡ (bp/person/year) ¡ Year ¡ Event ¡ 1870 ¡ Miescher: ¡ ¡Discovers ¡DNA ¡ 1940 ¡ Avery: ¡ ¡Proposes ¡DNA ¡as ¡“GeneNc ¡Material” ¡ 1953 ¡ Watson ¡& ¡Crick: ¡ ¡Double ¡Helix ¡Structure ¡of ¡DNA ¡ 1 ¡ 1965 ¡ Holley: ¡ ¡Sequenced ¡transfer ¡RNA ¡from ¡Yeast ¡ 1,500 ¡ 1977 ¡ Maxam ¡& ¡Gilbert: ¡"DNA ¡sequencing ¡by ¡chemical ¡degradaNon” ¡ Sanger: ¡“DNA ¡sequencing ¡with ¡chain-­‑terminaNng ¡inhibitors” ¡ 1980 ¡ Messing: ¡DNA ¡cloning ¡ 15,000 ¡ 1981 ¡ Messing: ¡Messing ¡and ¡his ¡colleagues ¡developed ¡“shotgun ¡ sequencing” ¡method ¡ 25,000 ¡ 1986 ¡ Hood ¡et ¡al.: ¡ ¡ParNal ¡AutomaNon ¡ 1987 ¡ ABI ¡markets ¡the ¡first ¡sequencing ¡plaXorm, ¡ABI ¡370 ¡

Landmarks ¡in ¡Sequencing ¡

Efficiency ¡ ¡ (bp/person/year) ¡ Year ¡ Event ¡ 50,000 ¡ 1990 ¡ NIH ¡begins ¡large-­‑scale ¡sequencing ¡trials ¡of ¡bacteria ¡genomes. ¡ 200,000 ¡ 1995 ¡ Craig ¡Venture ¡and ¡Hamilton ¡Smith ¡at ¡the ¡InsNtute ¡for ¡ Genomic ¡Research ¡(TIGR) ¡published ¡the ¡first ¡complete ¡ genome ¡of ¡a ¡free-­‑living ¡organism ¡in ¡Science. ¡ ¡This ¡marks ¡the ¡ first ¡use ¡of ¡whole-­‑genome ¡shotgun ¡sequencing, ¡eliminaNng ¡ the ¡need ¡for ¡iniNal ¡mapping ¡efforts. ¡ ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Science. ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Nature. ¡ 50,000,000 ¡ 2002 ¡ 454 ¡Life ¡Sciences ¡comes ¡out ¡with ¡a ¡pyrosequencing ¡machine. ¡ 100,000,000 ¡ 2008 ¡ Next ¡generaNon ¡sequencing ¡machines ¡arrive. ¡ Huge ¡ 2011 ¡ Oxford ¡Nanopore: ¡600 ¡Million ¡base ¡pairs ¡per ¡hour. ¡ ¡

Robert ¡Holley ¡and ¡team ¡in ¡1965 ¡ Watson ¡and ¡Crick ¡ Messing: ¡World’s ¡most-­‑cited ¡ ¡ scienNst ¡ Francis ¡and ¡Collins: ¡Private ¡Human ¡Genome ¡project. ¡ ¡

Next-­‑Gen ¡Sequencing ¡PlaXorms ¡

454/Roche ¡GS-­‑20/FLX ¡ (2005) ¡ PacBio ¡RS ¡(2009-­‑2010) ¡ 3rd ¡generaNon? ¡ Illumina ¡HISeq ¡ ¡ (2007) ¡

Comparison ¡of ¡NGS ¡PlaXorms ¡

Technology ¡ Reads ¡per ¡run ¡ Average ¡Read ¡ Length ¡ bp ¡per ¡run ¡ Types ¡of ¡ errors ¡ 454 ¡(Roche) ¡ 400,000 ¡ 250-­‑1000bp ¡ 70 ¡Million ¡ SubsNtuNon ¡ SoLID ¡(ABI) ¡ 88-­‑132 ¡Million ¡ 35bp ¡ 1 ¡Billion ¡ Illumina ¡HISeq ¡ 150 ¡Million ¡ 100 ¡– ¡200bp ¡ 15 ¡Billion ¡ SubsNtuNon ¡ with ¡ exponenNal ¡ increase ¡ PacBio ¡ 45,000 ¡ 1000-­‑2000bp ¡ 45 ¡Million ¡ InserNons ¡and ¡ deleNons ¡

\ ¡

Sequencing ¡Methods ¡and ¡ Terminology ¡

Sanger ¡Sequencing ¡

• The ¡key ¡principle ¡of ¡the ¡Sanger ¡method ¡was ¡the ¡

dideoxynucleoNde ¡triphosphates ¡(ddNTPs) ¡as ¡ DNA ¡chain ¡terminators. ¡ ¡

• These ¡ddNTPs ¡will ¡also ¡be ¡radioacNvely ¡for ¡

detecNon ¡in ¡automated ¡sequencing ¡machines. ¡

• PosiNves: ¡longer ¡reads ¡(600 ¡to ¡1000 ¡bp). ¡
• NegaNves: ¡poor ¡coverage ¡(6x), ¡expensive, ¡
• inaccurate. ¡ ¡ ¡
• SNll ¡commonly ¡used ¡for ¡small ¡scale ¡sequencing. ¡

Sanger ¡Sequencing ¡Video ¡

Sanger ¡Sequencing ¡

SHEAR DNA target sample

Sanger ¡Sequencing ¡

SHEAR DNA target sample

A ¡ A ¡ A ¡ A ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡

Close each fragment many times.

Sanger ¡Sequencing ¡

28 ¡

SHEAR DNA target sample

A ¡ A ¡ A ¡ A ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡ C ¡ G ¡ T ¡ A C G T

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A DNA ¡polymerase ¡ Primer ¡

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A DNA ¡polymerase ¡ Primer ¡ Primer ¡ DNA ¡polymerase ¡ A ¡ C ¡ G ¡ T ¡ A

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A Primer ¡ DNA ¡polymerase ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡

G ¡

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A Primer ¡ DNA ¡polymerase ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡

G ¡ G ¡

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A Primer ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡

C ¡ G ¡ G ¡

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A Primer ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡

G ¡ A ¡ C ¡ G ¡ G ¡

Sanger ¡Sequencing ¡

A ¡ C ¡ G ¡ T ¡ A Primer ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡ T ¡

Sanger ¡Sequencing ¡

Primer ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡

Primer ¡ A ¡ A ¡ A ¡ G ¡ G ¡ C ¡ C ¡ C ¡ T ¡ C ¡ T ¡ A ¡ C ¡ T ¡ ConNnue ¡unNl ¡all ¡strands ¡of ¡DNA ¡ ¡ have ¡undergone ¡this ¡reacNon. ¡ ¡If ¡you ¡ choose ¡the ¡reagents ¡correctly ¡then ¡you ¡ ¡ should ¡have ¡all ¡possible ¡A-­‑terminated ¡ ¡ strands; ¡resulNng ¡in ¡sequences ¡of ¡varying ¡

• lengths. ¡

Sanger ¡Sequencing ¡

Sanger ¡Sequencing ¡

In ¡the ¡radioacNve ¡gel, ¡the ¡longer ¡DNA ¡fragments ¡ move ¡to ¡the ¡bopom ¡and ¡the ¡shorter ¡ones ¡move ¡to ¡ ¡ the ¡top. ¡ ¡ ¡ ¡ Aierward ¡the ¡sequence ¡can ¡be ¡read ¡off ¡by ¡going ¡ ¡ from ¡top ¡to ¡bopom. ¡

To ¡recap… ¡

• Sanger ¡Sequencing: ¡ ¡

– Run ¡a ¡PCR ¡reacNon ¡in ¡the ¡presence ¡of ¡a ¡bunch ¡of ¡ddNTPs, ¡ with ¡each ¡different ¡base ¡pair ¡dyed ¡a ¡different ¡color. ¡ ¡ – Measure ¡the ¡length ¡and ¡color ¡of ¡the ¡resulNng ¡fragments ¡of ¡ DNA, ¡and ¡use ¡that ¡to ¡work ¡out ¡the ¡sequence. ¡

• Requires ¡a ¡lot ¡of ¡space ¡and ¡Nme: ¡you ¡need ¡a ¡place ¡to ¡

run ¡the ¡reacNon, ¡and ¡then ¡you ¡need ¡a ¡capillary ¡tube ¡or ¡ a ¡gel ¡to ¡determine ¡the ¡length ¡of ¡the ¡DNA. ¡ ¡

– You ¡could ¡only ¡run ¡perhaps ¡a ¡hundred ¡of ¡these ¡reacNons ¡ at ¡any ¡one ¡Nme. ¡ ¡ – There ¡are ¡3 ¡billion ¡base ¡pairs ¡of ¡DNA ¡in ¡the ¡human ¡ genome, ¡meaning ¡about ¡6 ¡million ¡500-­‑base ¡pair ¡fragments ¡

• f ¡DNA. ¡

40 ¡

Celera ¡Sequencing ¡(2001) ¡

• 300 ¡ABI ¡DNA ¡sequencing ¡plaXorms ¡
• 50 ¡producNon ¡staff ¡
• 20,000 ¡square ¡feet ¡of ¡wet ¡lab ¡space ¡
• 1 ¡million ¡dollars ¡/ ¡year ¡for ¡electrical ¡service ¡
• 10 ¡million ¡dollars ¡in ¡reagents ¡

Total ¡cost ¡of ¡human ¡genome: ¡2.7 ¡Billion ¡dollars ¡

Celera ¡Sequencing ¡(2001) ¡

• 300 ¡ABI ¡DNA ¡sequencing ¡plaXorms ¡
• 50 ¡producNon ¡staff ¡
• 20,000 ¡square ¡feet ¡of ¡wet ¡lab ¡space ¡
• 1 ¡million ¡dollars ¡/ ¡year ¡for ¡electrical ¡service ¡
• 10 ¡million ¡dollars ¡in ¡reagents ¡

Current ¡cost ¡of ¡human ¡genome: ¡< ¡10,000 ¡$ ¡

• Second ¡GeneraNon ¡sequencing ¡techniques ¡
• vercome ¡the ¡restricNons ¡by ¡finding ¡ways ¡to ¡

sequence ¡the ¡DNA ¡without ¡having ¡to ¡move ¡it ¡

• around. ¡ ¡
• You ¡sNck ¡the ¡bit ¡of ¡DNA ¡you ¡want ¡to ¡sequence ¡

in ¡a ¡liple ¡dot, ¡called ¡a ¡cluster, ¡and ¡you ¡do ¡the ¡ sequencing ¡there; ¡as ¡a ¡result, ¡you ¡can ¡pack ¡ many ¡millions ¡of ¡clusters ¡into ¡one ¡machine. ¡ ¡

Second/Next ¡GeneraNon ¡Sequencing ¡

Sequencing ¡a ¡strand ¡of ¡DNA ¡while ¡ keeping ¡it ¡held ¡in ¡place ¡is ¡tricky, ¡and ¡ requires ¡a ¡lot ¡of ¡cleverness. ¡

Illumina ¡Sequencing ¡Pipeline ¡

• 1. ¡Sample ¡preparaNon ¡(1-­‑5 ¡days) ¡

ligate ¡adapters ¡

• 2. ¡Cluster ¡generaNon ¡on ¡flow ¡cell ¡

¡

• 3. ¡Sequencing ¡and ¡Imaging ¡(1 ¡week) ¡

(1.5 ¡days) ¡

• 4. ¡Analysis ¡(days, ¡months, ¡years…) ¡

Illumina ¡Sequencing: ¡Video ¡

We ¡mulNply ¡up ¡the ¡template ¡stand, ¡i.e. ¡the ¡bit ¡of ¡DNA ¡that ¡we ¡ are ¡sequencing, ¡and ¡sNck ¡on ¡a ¡few ¡bases ¡of ¡‘adaptor ¡sequence’; ¡ this ¡sequence ¡sNcks ¡on ¡to ¡complementary ¡bits ¡of ¡DNA ¡stuck ¡to ¡a ¡ surface, ¡which ¡holds ¡the ¡DNA ¡in ¡place ¡while ¡we ¡sequence ¡it: ¡

We ¡then ¡flood ¡the ¡DNA ¡with ¡RT-­‑bases. ¡We ¡also ¡add ¡a ¡ polymerase ¡enzyme, ¡which ¡incorporates ¡the ¡RT-­‑base ¡into ¡the ¡ new ¡strand ¡that ¡is ¡complementary ¡to ¡the ¡template ¡strand: ¡

We ¡then ¡wash ¡away ¡all ¡the ¡RT-­‑bases, ¡leaving ¡just ¡those ¡that ¡ were ¡incorporated ¡into ¡the ¡new ¡strand; ¡we ¡can ¡read ¡off ¡what ¡ base ¡this ¡is ¡by ¡looking ¡at ¡the ¡color ¡of ¡the ¡dye: ¡

• Finally, ¡we ¡send ¡in ¡the ¡cleavage ¡enzyme, ¡which ¡cuts ¡
• ff ¡the ¡terminator ¡region ¡and ¡the ¡dye, ¡leaving ¡a ¡

normal ¡base ¡pair. ¡We ¡can ¡then ¡start ¡again ¡to ¡ sequence ¡the ¡next ¡base ¡pair. ¡

• In ¡a ¡single ¡Illumina ¡machine ¡we ¡have ¡hundreds ¡of ¡

millions ¡of ¡these ¡clusters; ¡cameras ¡look ¡at ¡all ¡of ¡these ¡ dots ¡and ¡record ¡how ¡they ¡change ¡color ¡over ¡Nme, ¡ allowing ¡you ¡to ¡determine ¡the ¡sequence ¡of ¡bases ¡of ¡ millions ¡of ¡bits ¡of ¡DNA ¡at ¡once. ¡ ¡

• Sequencing ¡method ¡is ¡actually ¡prepy ¡inefficient, ¡

however, ¡the ¡machine ¡is ¡capable ¡of ¡sequencing ¡ millions ¡of ¡fragments ¡of ¡DNA ¡at ¡once. ¡

Inside ¡the ¡Illumina ¡Machine ¡

51 ¡

Flow ¡Cell ¡Imaging ¡

A ¡flow ¡cell ¡ contains ¡8 ¡lanes ¡

Each ¡lane ¡contains ¡three ¡columns ¡of ¡Nles ¡ Each ¡column ¡contains ¡100 ¡Nles ¡ 20K ¡to ¡30K ¡clusters ¡ ¡ Each ¡Nle ¡is ¡imaged ¡four ¡Nmes ¡per ¡cycle, ¡ ¡ which ¡is ¡one ¡image ¡per ¡base ¡

Conclusions ¡

Sample ¡PreparaNon ¡ Sequencing ¡ Assembly ¡ Analysis ¡

Fragments ¡ Reads ¡ ConNgs ¡ “…the ¡ability ¡to ¡determine ¡DNA ¡ sequences ¡is ¡starNng ¡to ¡outrun ¡ the ¡ability ¡of ¡researchers ¡to ¡ store, ¡transmit ¡and ¡especially ¡to ¡ analyze ¡the ¡data.” ¡

¡

• ­‑ ¡New ¡York ¡Times, ¡November ¡30, ¡2011 ¡

What ¡challenges ¡are ¡lei? ¡

• Amount ¡of ¡data ¡is ¡starNng ¡to ¡be ¡overwhelm ¡

biologists ¡and ¡data ¡analysis ¡people ¡(aka ¡ bioinformaNcs ¡people) ¡are ¡in ¡more ¡demand ¡

• Personal ¡health ¡care ¡is ¡changing ¡(already); ¡i.e. ¡

23andme, ¡sequenom ¡ ¡

• Data ¡acquisiNon ¡is ¡sNll ¡difficult ¡in ¡some ¡case ¡

and ¡advancements ¡are ¡needed ¡in ¡this ¡area ¡

• SNll ¡cannot ¡sequence ¡some ¡genomes ¡

What ¡will ¡happen ¡in ¡your ¡lifeNme? ¡

“We ¡used ¡to ¡think ¡that ¡our ¡fate ¡was ¡in ¡our ¡stars. ¡ Now ¡we ¡know ¡that, ¡in ¡large ¡measure, ¡our ¡fate ¡is ¡in ¡

• ur ¡genes.” ¡-­‑Francis ¡Crick ¡
• You’ll ¡be ¡able ¡to ¡sequence ¡your ¡genome ¡and ¡

know ¡the ¡implicaNons ¡of ¡your ¡genotype ¡

• Medical ¡diagnosis ¡will ¡change ¡
• Plant ¡and ¡crop ¡producNon ¡will ¡be ¡affected ¡
• We’ll ¡have ¡an ¡improved ¡knowledge ¡of ¡ancestry ¡of ¡
• urselves ¡and ¡other ¡species ¡