Genome Sequencing (Part 1) Lecture 4: August 30, 2012 - PowerPoint PPT Presentation

Genome ¡Sequencing ¡(Part ¡1) ¡ Lecture ¡4: ¡August ¡30, ¡2012 ¡ ¡

Review ¡from ¡Last ¡Lecture ¡

De ¡novo ¡vs. ¡Re-­‑sequencing ¡ • De ¡novo ¡ assembly ¡(“from ¡the ¡beginning”) ¡ implies ¡that ¡you ¡have ¡no ¡prior ¡knowledge ¡of ¡ the ¡genome. ¡ ¡No ¡reference, ¡no ¡conNgs, ¡only ¡ reads. ¡ • Re-­‑sequencing ¡assembly ¡assumes ¡you ¡have ¡a ¡ copy ¡of ¡the ¡reference ¡genome ¡(that ¡has ¡been ¡ verified ¡to ¡a ¡certain ¡degree). ¡ • The ¡programs ¡that ¡work ¡for ¡re-­‑sequencing ¡will ¡ not ¡work ¡for ¡de ¡novo ¡and ¡vice ¡versa. ¡However, ¡ both ¡can ¡create ¡copies ¡of ¡the ¡genome. ¡

De ¡novo ¡vs. ¡Re-­‑sequencing ¡

Sample ¡PreparaNon ¡ Re-sequencing (LOCAS, Shrimp) requires 15x to 30x coverage. Anything less and re-sequencing programs will not produce results or produce questionable results. Fragments

Sample ¡PreparaNon ¡ De-novo assembly requires higher coverage. At least 30x but upwards to 100x’s coverage. Most de novo assemblers require paired-end data. Fragments

IntroducNon ¡and ¡History ¡

Sample ¡PreparaNon ¡

Sample ¡PreparaNon ¡ Fragments ¡

Sample ¡PreparaNon ¡ Fragments ¡ Sequencing ¡ Next ¡GeneraNon ¡Sequencing ¡(NGS) ¡ ACGTAGAATCGACCATG ACGTAGAATACGTAGAA GGGACGTAGAATACGAC Reads ¡

Sample ¡PreparaNon ¡ Fragments ¡ Sequencing ¡ Reads ¡ ACGTAGAATACGTAGAA Assembly ¡ ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAAACAGATTAGAGAG… ConNgs ¡

Sample ¡PreparaNon ¡ Fragments ¡ Sequencing ¡ Reads ¡ Assembly ¡ ConNgs ¡ Analysis ¡

Sample ¡PreparaNon ¡ Our ¡focus ¡for ¡today’s ¡lecture: ¡ 1. Comparison ¡of ¡sequencing ¡ Fragments ¡ plaXorms ¡ 2. Details ¡of ¡sample ¡preparaNon ¡ Sequencing ¡ 3. DefiniNons ¡and ¡terminologies ¡ concerning ¡data ¡and ¡ sequencing ¡plaXorms ¡ Reads ¡ Assembly ¡ ConNgs ¡ Analysis ¡

Landmarks ¡in ¡Sequencing ¡ Efficiency ¡ ¡ Year ¡ Event ¡ (bp/person/year) ¡ 1870 ¡ Miescher: ¡ ¡Discovers ¡DNA ¡ 1940 ¡ Avery: ¡ ¡Proposes ¡DNA ¡as ¡“GeneNc ¡Material” ¡ 1953 ¡ Watson ¡& ¡Crick: ¡ ¡Double ¡Helix ¡Structure ¡of ¡DNA ¡ 1 ¡ 1965 ¡ Holley: ¡ ¡Sequenced ¡transfer ¡RNA ¡from ¡Yeast ¡ 1,500 ¡ 1977 ¡ Maxam ¡& ¡Gilbert: ¡"DNA ¡sequencing ¡by ¡chemical ¡degradaNon” ¡ Sanger: ¡“DNA ¡sequencing ¡with ¡chain-­‑terminaNng ¡inhibitors” ¡ 1980 ¡ Messing: ¡DNA ¡cloning ¡ 15,000 ¡ 1981 ¡ Messing: ¡Messing ¡and ¡his ¡colleagues ¡developed ¡“shotgun ¡ sequencing” ¡method ¡ 25,000 ¡ 1986 ¡ Hood ¡et ¡al.: ¡ ¡ParNal ¡AutomaNon ¡ 1987 ¡ ABI ¡markets ¡the ¡first ¡sequencing ¡plaXorm, ¡ABI ¡370 ¡

Landmarks ¡in ¡Sequencing ¡ Efficiency ¡ ¡ Year ¡ Event ¡ (bp/person/year) ¡ 50,000 ¡ 1990 ¡ NIH ¡begins ¡large-­‑scale ¡sequencing ¡trials ¡of ¡bacteria ¡genomes. ¡ 200,000 ¡ 1995 ¡ Craig ¡Venture ¡and ¡Hamilton ¡Smith ¡at ¡the ¡InsNtute ¡for ¡ Genomic ¡Research ¡(TIGR) ¡published ¡the ¡first ¡complete ¡ genome ¡of ¡a ¡free-­‑living ¡organism ¡in ¡Science. ¡ ¡This ¡marks ¡the ¡ first ¡use ¡of ¡whole-­‑genome ¡shotgun ¡sequencing, ¡eliminaNng ¡ the ¡need ¡for ¡iniNal ¡mapping ¡efforts. ¡ ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Science. ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Nature. ¡ 50,000,000 ¡ 2002 ¡ 454 ¡Life ¡Sciences ¡comes ¡out ¡with ¡a ¡pyrosequencing ¡machine. ¡ 100,000,000 ¡ 2008 ¡ Next ¡generaNon ¡sequencing ¡machines ¡arrive. ¡ Huge ¡ 2011 ¡ Oxford ¡Nanopore: ¡600 ¡Million ¡base ¡pairs ¡per ¡hour. ¡ ¡

Robert ¡Holley ¡and ¡team ¡in ¡1965 ¡ Watson ¡and ¡Crick ¡ Messing: ¡World’s ¡most-­‑cited ¡ ¡ scienNst ¡ Francis ¡and ¡Collins: ¡Private ¡Human ¡Genome ¡project. ¡ ¡

Next-­‑Gen ¡Sequencing ¡PlaXorms ¡ 454/Roche ¡GS-­‑20/FLX ¡ (2005) ¡ PacBio ¡RS ¡(2009-­‑2010) ¡ 3 rd ¡generaNon? ¡ Illumina ¡HISeq ¡ ¡ (2007) ¡

Comparison ¡of ¡NGS ¡PlaXorms ¡ Technology ¡ Reads ¡per ¡run ¡ Average ¡Read ¡ bp ¡per ¡run ¡ Types ¡of ¡ Length ¡ errors ¡ 454 ¡(Roche) ¡ 400,000 ¡ 250-­‑1000bp ¡ 70 ¡Million ¡ SubsNtuNon ¡ SoLID ¡(ABI) ¡ 88-­‑132 ¡Million ¡ 35bp ¡ 1 ¡Billion ¡ Illumina ¡HISeq ¡ 150 ¡Million ¡ 100 ¡– ¡200bp ¡ 15 ¡Billion ¡ SubsNtuNon ¡ with ¡ exponenNal ¡ increase ¡ PacBio ¡ 45,000 ¡ 1000-­‑2000bp ¡ 45 ¡Million ¡ InserNons ¡and ¡ deleNons ¡ \ ¡

Sequencing ¡Methods ¡and ¡ Terminology ¡

Sanger ¡Sequencing ¡ • The ¡key ¡principle ¡of ¡the ¡Sanger ¡method ¡was ¡the ¡ dideoxynucleoNde ¡triphosphates ¡(ddNTPs) ¡as ¡ DNA ¡chain ¡terminators. ¡ ¡ • These ¡ddNTPs ¡will ¡also ¡be ¡radioacNvely ¡for ¡ detecNon ¡in ¡automated ¡sequencing ¡machines. ¡ • PosiNves: ¡longer ¡reads ¡(600 ¡to ¡1000 ¡bp). ¡ • NegaNves: ¡poor ¡coverage ¡(6x), ¡expensive, ¡ inaccurate. ¡ ¡ ¡ • SNll ¡commonly ¡used ¡for ¡small ¡scale ¡sequencing. ¡

Sanger ¡Sequencing ¡Video ¡

Sanger ¡Sequencing ¡ DNA target sample SHEAR

Sanger ¡Sequencing ¡ DNA target sample SHEAR Close each fragment many times. T ¡ T ¡ A ¡ A ¡ T ¡ A ¡ A ¡ T ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡

Sanger ¡Sequencing ¡ DNA target sample SHEAR T T ¡ T ¡ A ¡ A ¡ A T ¡ A ¡ A ¡ T ¡ C C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G 28 ¡

Sanger ¡Sequencing ¡ Primer ¡ DNA ¡polymerase ¡ T ¡ A A ¡ C ¡ G ¡

Sanger ¡Sequencing ¡ Primer ¡ DNA ¡polymerase ¡ T ¡ A A ¡ C ¡ G ¡ T ¡ A A ¡ Primer ¡ C ¡ G ¡ DNA ¡polymerase ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ DNA ¡polymerase ¡ C ¡ C ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ DNA ¡polymerase ¡ C ¡ G ¡ C ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ C ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ C ¡ A ¡ T ¡ T ¡ A A ¡ C ¡ G ¡ C ¡ G ¡ T ¡ A ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ C ¡ G ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡

Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ C ¡ G ¡ A ¡ C ¡ T ¡ A ¡ C ¡ ConNnue ¡unNl ¡all ¡strands ¡of ¡DNA ¡ ¡ T ¡ have ¡undergone ¡this ¡reacNon. ¡ ¡If ¡you ¡ choose ¡the ¡reagents ¡correctly ¡then ¡you ¡ ¡ A ¡ should ¡have ¡all ¡possible ¡A-­‑terminated ¡ ¡ C ¡ strands; ¡resulNng ¡in ¡sequences ¡of ¡varying ¡ T ¡ lengths. ¡

Sanger ¡Sequencing ¡

Sanger ¡Sequencing ¡ In ¡the ¡radioacNve ¡gel, ¡the ¡longer ¡DNA ¡fragments ¡ move ¡to ¡the ¡bopom ¡and ¡the ¡shorter ¡ones ¡move ¡to ¡ ¡ the ¡top. ¡ ¡ ¡ ¡ Aierward ¡the ¡sequence ¡can ¡be ¡read ¡off ¡by ¡going ¡ ¡ from ¡top ¡to ¡bopom. ¡