Genome ¡Sequencing ¡
Introduc1on ¡and ¡History ¡
Sample ¡Prepara1on ¡
Sample ¡Prepara1on ¡ Fragments ¡
Sample ¡Prepara1on ¡ Fragments ¡ Sequencing ¡ Next ¡Genera1on ¡Sequencing ¡(NGS) ¡ ACGTAGAATCGACCATG ACGTAGAATACGTAGAA GGGACGTAGAATACGAC Reads ¡
Sample ¡Prepara1on ¡ Fragments ¡ Sequencing ¡ Reads ¡ ACGTAGAATACGTAGAA Assembly ¡ ACGTAGAATCGACCATG GGGACGTAGAATACGAC ACGTAGAATACGTAGAAACAGATTAGAGAG… Con1gs ¡
Sample ¡Prepara1on ¡ Fragments ¡ Sequencing ¡ Reads ¡ Assembly ¡ Con1gs ¡ Analysis ¡
Reference ¡Genome ¡ 9 ¡
De ¡novo ¡vs. ¡Re-‑sequencing ¡ • De ¡novo ¡ assembly ¡(“from ¡the ¡beginning”) ¡ implies ¡that ¡you ¡have ¡ no ¡prior ¡knowledge ¡of ¡ the ¡genome. ¡ ¡ ¡ • Re-‑sequencing ¡assembly ¡assumes ¡you ¡have ¡a ¡ copy ¡of ¡the ¡reference ¡genome ¡(that ¡has ¡been ¡ verified ¡to ¡a ¡certain ¡degree). ¡ • The ¡programs ¡that ¡work ¡for ¡re-‑sequencing ¡will ¡ not ¡work ¡for ¡ de ¡novo . ¡ ¡
De ¡novo ¡vs. ¡Re-‑sequencing ¡
Sample ¡Prepara1on ¡ Re-sequencing (LOCAS, Shrimp) requires 15x to 30x coverage. Anything less and re-sequencing programs will not produce results or produce questionable results. Fragments
Sample ¡Prepara1on ¡ De-novo assembly requires higher coverage. At least 30x but upwards to 100x’s coverage. Most de novo assemblers require paired-end data. Fragments
Sample ¡Prepara1on ¡ Our ¡focus ¡for ¡today’s ¡lecture: ¡ 1. Comparison ¡of ¡sequencing ¡ Fragments ¡ plaSorms ¡ 2. Details ¡of ¡sample ¡prepara1on ¡ Sequencing ¡ 3. Defini1ons ¡and ¡terminologies ¡ concerning ¡data ¡and ¡ sequencing ¡plaSorms ¡ Reads ¡ Assembly ¡ Con1gs ¡ Analysis ¡
History ¡and ¡Background ¡
Landmarks ¡in ¡Sequencing ¡ Efficiency ¡ ¡ Year ¡ Event ¡ (bp/person/ year) ¡ 1870 ¡ Miescher: ¡ ¡Discovers ¡DNA ¡ 1940 ¡ Avery: ¡ ¡Proposes ¡DNA ¡as ¡“Gene1c ¡Material” ¡ 1953 ¡ Watson ¡& ¡Crick: ¡ ¡Double ¡Helix ¡Structure ¡of ¡DNA ¡ 1 ¡ 1965 ¡ Holley: ¡ ¡transfer ¡RNA ¡from ¡Yeast ¡ 1,500 ¡ 1977 ¡ Maxam ¡& ¡Gilbert: ¡"DNA ¡sequencing ¡by ¡chemical ¡ degrada1on” ¡ Sanger: ¡“DNA ¡sequencing ¡with ¡chain-‑termina1ng ¡ inhibitors” ¡ 15,000 ¡ 1981 ¡ Messing ¡and ¡his ¡colleagues ¡developed ¡“shotgun ¡ sequencing” ¡method ¡ 25,000 ¡ 1987 ¡ ABI ¡markets ¡the ¡first ¡sequencing ¡plaSorm, ¡ABI ¡ 370 ¡
Landmarks ¡in ¡Sequencing ¡ Efficiency ¡ ¡ Year ¡ Event ¡ (bp/person/year) ¡ 50,000 ¡ 1990 ¡ NIH ¡begins ¡large-‑scale ¡sequencing ¡bacteria ¡genomes. ¡ 200,000 ¡ 1995 ¡ Craig ¡Venture ¡and ¡Hamilton ¡Smith ¡at ¡the ¡Ins1tute ¡for ¡ Genomic ¡Research ¡(TIGR) ¡published ¡the ¡first ¡complete ¡ genome ¡of ¡a ¡free-‑living ¡organism ¡in ¡Science. ¡ ¡This ¡marks ¡the ¡ first ¡use ¡of ¡whole-‑genome ¡shotgun ¡sequencing, ¡elimina1ng ¡ the ¡need ¡for ¡ini1al ¡mapping ¡efforts. ¡ ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Science. ¡ 2001 ¡ A ¡drai ¡of ¡the ¡human ¡genome ¡was ¡published ¡in ¡Nature. ¡ 50,000,000 ¡ 2002 ¡ 454 ¡Life ¡Sciences ¡comes ¡out ¡with ¡a ¡pyrosequencing ¡machine. ¡ 100,000,000 ¡ 2008 ¡ Next ¡genera1on ¡sequencing ¡machines ¡arrive. ¡ Huge ¡ 2011 ¡ Oxford ¡Nanopore: ¡600 ¡Million ¡base ¡pairs ¡per ¡hour. ¡ ¡
Robert ¡Holley ¡and ¡team ¡in ¡1965 ¡ Watson ¡and ¡Crick ¡ Messing: ¡World’s ¡most-‑cited ¡ ¡ scien1st ¡ Francis ¡and ¡Collins: ¡Private ¡Human ¡Genome ¡project. ¡ ¡
Next-‑Gen ¡Sequencing ¡PlaSorms ¡ 454/Roche ¡GS-‑20/FLX ¡ (2005) ¡ PacBio ¡RS ¡(2009-‑2010) ¡ 3 rd ¡genera1on? ¡ Illumina ¡HISeq ¡ ¡ (2007) ¡
23 ¡
Comparison ¡of ¡PlaSorms ¡ Technology ¡ Reads ¡per ¡run ¡ Average ¡Read ¡ bp ¡per ¡run ¡ Types ¡of ¡ Length ¡ errors ¡ 454 ¡(Roche) ¡ 400,000 ¡ 250-‑1000bp ¡ 70 ¡Million ¡ Subs1tu1on ¡ SoLID ¡(ABI) ¡ 88-‑132 ¡Million ¡ 35bp ¡ 1 ¡Billion ¡ Illumina ¡HISeq ¡ 150 ¡Million ¡ 100 ¡– ¡200bp ¡ 15 ¡Billion ¡ Subs1tu1on ¡ with ¡ exponen1al ¡ increase ¡ PacBio ¡ 45,000 ¡ 1000-‑2000bp ¡ 45 ¡Million ¡ Inser1ons ¡and ¡ dele1ons ¡ \ ¡
Sequencing ¡Methods ¡and ¡ Terminology ¡
Sanger ¡Sequencing ¡ • The ¡key ¡principle ¡of ¡the ¡Sanger ¡method ¡was ¡the ¡ dideoxynucleo1de ¡triphosphates ¡(ddNTPs) ¡as ¡ DNA ¡chain ¡terminators. ¡ ¡ • These ¡ddNTPs ¡will ¡also ¡be ¡radioac1vely ¡for ¡ detec1on ¡in ¡automated ¡sequencing ¡machines. ¡ • Posi1ves: ¡longer ¡reads ¡(600 ¡to ¡1000 ¡bp). ¡ • Nega1ves: ¡poor ¡coverage ¡(6x), ¡expensive, ¡ inaccurate. ¡ ¡ ¡ • S1ll ¡commonly ¡used ¡for ¡small ¡scale ¡sequencing. ¡
Sanger ¡Sequencing ¡Video ¡
Sanger ¡Sequencing ¡ DNA target sample SHEAR
Sanger ¡Sequencing ¡ DNA target sample SHEAR Close each fragment many times. T ¡ T ¡ A ¡ A ¡ T ¡ A ¡ A ¡ T ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡
Sanger ¡Sequencing ¡ DNA target sample SHEAR T T ¡ T ¡ A ¡ A ¡ A T ¡ A ¡ A ¡ T ¡ C C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G 30 ¡
Sanger ¡Sequencing ¡ Primer ¡ DNA ¡polymerase ¡ T ¡ A A ¡ C ¡ G ¡
Sanger ¡Sequencing ¡ Primer ¡ DNA ¡polymerase ¡ T ¡ A A ¡ C ¡ G ¡ T ¡ A A ¡ Primer ¡ C ¡ G ¡ DNA ¡polymerase ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ DNA ¡polymerase ¡ C ¡ C ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ DNA ¡polymerase ¡ C ¡ G ¡ C ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ C ¡ A ¡ T ¡ A A ¡ C ¡ C ¡ G ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ G ¡ C ¡ G ¡ G ¡ C ¡ A ¡ T ¡ T ¡ A A ¡ C ¡ G ¡ C ¡ G ¡ T ¡ A ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ C ¡ G ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡ A ¡ C ¡ T ¡
Sanger ¡Sequencing ¡ A ¡ Primer ¡ G ¡ C ¡ C ¡ G ¡ A ¡ C ¡ T ¡ A ¡ C ¡ Con1nue ¡un1l ¡all ¡strands ¡of ¡DNA ¡ ¡ T ¡ have ¡undergone ¡this ¡reac1on. ¡ ¡If ¡you ¡ choose ¡the ¡reagents ¡correctly ¡then ¡you ¡ ¡ A ¡ should ¡have ¡all ¡possible ¡A-‑terminated ¡ ¡ C ¡ strands; ¡resul1ng ¡in ¡sequences ¡of ¡varying ¡ T ¡ lengths. ¡
Sanger ¡Sequencing ¡
Sanger ¡Sequencing ¡ In ¡the ¡radioac1ve ¡gel, ¡the ¡longer ¡DNA ¡fragments ¡ move ¡to ¡the ¡bopom ¡and ¡the ¡shorter ¡ones ¡move ¡to ¡ ¡ the ¡top. ¡ ¡ ¡ ¡ Aierward ¡the ¡sequence ¡can ¡be ¡read ¡off ¡by ¡going ¡ ¡ from ¡top ¡to ¡bopom. ¡
Recommend
More recommend
