SLIDE 18 www.fasteris.com
Metagenomics protocols
IMPORTANT NOTICE
This document provides information for an application for Illumina technology that has been demonstrated internally and may be of interest to customers. This information is provided as‐is and is not an Illumina product and is not accompanied by any rights or
- warranties. Customers using or adapting this information should obtain any licenses
required and materials from authorized vendors. Illumina products mentioned herein are for research use only unless marked otherwise. While customer feedback is welcomed, this application is not supported by Illumina Technical Support and Field Application Scientists. Part # 15044223 Rev. B
Page 1
16S Metagenomic Sequencing Library Preparation
Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System
Introduction 2 16S Library Preparation Workflow 5 Amplicon PCR 6 PCR Clean‐Up 8 Index PCR 10 PCR Clean‐Up 2 13 [Optional] Validate Library 15 Library Quantification, Normalization, and Pooling 16 Library Denaturing and MiSeq Sample Loading 17 MiSeq Reporter Metagenomics Workflow 20 Supporting Information 21 Figure 1 16S V3 and V4 Amplicon Workflow User‐defined forward and reverse primers that are complementary upstream and downstream of the region of interest are designed with overhang adapters, and used to amplify templates from genomic
- DNA. A subsequent limited‐cycle amplification step is performed to add multiplexing indices and
Illumina sequencing adapters. Libraries are normalized and pooled, and sequenced on the MiSeq system using v3 reagents.
Amplicon Primers
- The gene‐specific sequences used in this protocol target the 16S V3 and V4 region. They
are selected from the Klindworth et al. publication (Klindworth A, Pruesse E, Schweer T, Peplles J, Quast C, et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next‐generation sequencing‐based diversity studies. Nucleic Acids Res 41(1).) as the most promising bacterial primer pair. Illumina adapter
- verhang nucleotide sequences are added to the gene‐specific sequences. The full length
primer sequences, using standard IUPAC nucleotide nomenclature, to follow the protocol targeting this region are: 16S Amplicon PCR Forward Primer = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG 16S Amplicon PCR Reverse Primer = 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC
- This method can also be utilized to target other regions on the genome (either for 16S
with other sets of primer pairs, or non‐16S regions throughout the genome; ie any amplicon). The overhang adapter sequence must be added to the locus‐specific primer for the region to be targeted (Figure 1). The Illumina overhang adapter sequences to be added to locus‐specific sequences are: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐ specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]
Introduction Page 3
19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA
18
1-step PCR
Using primers with long tags (>60 nucleo-des) Advantage:
- Add the en-re illumina adapter sequence
in one step. Inconvenient:
Expensive and significant impact on amplifica-on efficiency
2-steps PCR
1st step with primers with medium tag (30 nt) 2nd step with illumina primers Advantage:
- Only one primer pair needed for 1st step.
Inconvenient:
Libraries with low complexity
All inserts in the same orienta-on with similar sequences => Impact on sequence quality
