cofounder alignment in minutes
play

Cofounder alignment in minutes Version 1.6 Version 1.1 One of the - PowerPoint PPT Presentation

Dec 25, 2022 •463 likes •611 views

Cofounder alignment in minutes Version 1.6 Version 1.1 One of the main reasons why startups fail are misaligned cofounders The track record for founders that dont already know each other is really badthe number one cause of early

  1. Cofounder alignment in minutes Version 1.6 Version 1.1

  2. One of the main reasons why startups fail are misaligned cofounders “The track record for founders that don’t already know each other is really bad…the number one cause of early death for startups is cofounder blowups.“ Sam Altman Chairman of Y Combinator, Co-chairman of OpenAI Photo by Steve Jennings/Getty Images for TechCrunch CC2.0

  3. Aligna.Team is a web-based application to easily measure cofounder alignment Cofounder alignment in minutes We prevent personal misalignment from killing your early-stage startup

  4. One cofounder creates their team conveniently per web-application

  5. The other cofounders get invited via shared link

  6. Every cofounder independently answers the structured questions and submits

  7. After everyone has submitted Aligna.Team calculates the score with just one click Supported by:

  8. Aligna.Team is specifically designed for cofounder needs Super easy and fast No account needed Alignment scores are Aligna.Team is for free cofounder alignment - store only the link to simple and based on but you can support us assessment your team current research with donations

  9. Start aligning your founding team or get contact with us Try Aligna.Team yourself https://aligna.team Questions or comments hello@aligna.team

  10. Help Aligna.Team as a supporter and reach thousands of early-stage startups Aligna.Team is a non-profit project for founders by founders and made with ❤ in Munich You will be listed in the supporters section on the team analysis page if you help us to maintain the infrastructure Contact us: supporters@aligna.team

  11. Appendix

  12. Working definition of misalignment “Misalignment is an opportunity to discuss the expectations, visions, goals, and strategies that lead to success. It’s okay to be misaligned, as long as there’s a next step. It’s a temporary condition.” https://close.com/resources/zero-to-thousands-hiten-shah-steli-efti/

  13. Aligned teams work up to... 12 x faster* *Source: Measured by TeamAlignment.Co (2015-2018) on 50 multicultural and pairs on a playful variation of the Tangram Game in Bangerter, A., & Clark, H. H. (2003). Navigating joint projects with dialogue. Cognitive Science, 27(2), 195-225.

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

F A $ H I O N F A $ H I O N T E A M Jonathan Colin Ho Rameesa Brian CEO/CoFounder

F A $ H I O N F A $ H I O N T E A M Jonathan Colin Ho Rameesa Brian CEO/CoFounder

F A $ H I O N F A $ H I O N T E A M Jonathan Colin Ho Rameesa Brian CEO/CoFounder CMO/CoFounder CFO/CoFounder CTO/CoFounder Issues - New fashion companies dont have the capital or network to properly promote their brand. - Many

891 views • 9 slides
Invitation to a New Kind of Database Sheer El Showk Cofounder, Lore Ai www.lore.ai Were

Invitation to a New Kind of Database Sheer El Showk Cofounder, Lore Ai www.lore.ai Were

Invitation to a New Kind of Database Sheer El Showk Cofounder, Lore Ai www.lore.ai Were Hiring! Overview 1. Problem statement (~2 minute) 2. (Proprietary) Solution: Datomics (~10 minutes) 3. Proposed Open Source Solution: (~8 minutes)

482 views • 18 slides
How to feature flag poorly & lessons learned Edith Harbaugh CEO & Cofounder

How to feature flag poorly & lessons learned Edith Harbaugh CEO & Cofounder

How to feature flag poorly & lessons learned Edith Harbaugh CEO & Cofounder @launchdarkly @Edith_H Cofounder & CEO: LaunchDarkly Edith Harbaugh Podcast cohost: To Be Continuous InfoQ, ReadWrite, DZone contributing author

900 views • 27 slides
Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
What is text alignment? Text alignment is the comparison of two or more parallel texts It

What is text alignment? Text alignment is the comparison of two or more parallel texts It

A tool for syntax-based intra-language text alignment Tariq Yousef, Chiara Palladino University of Leipzig Berlin Digital Classicist Seminars, November 29, 2016 What is text alignment? Text alignment is the comparison of two or more

688 views • 53 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment Rezoning initiative is the implementation tool for the four new Transit Oriented Development (TOD) zoning districts. Parcels in station areas along

257 views • 14 slides
Production: Designing for Testability Michael Bryzek mike@flow.io / @mbryzek Cofounder / CTO

Production: Designing for Testability Michael Bryzek mike@flow.io / @mbryzek Cofounder / CTO

Production: Designing for Testability Michael Bryzek mike@flow.io / @mbryzek Cofounder / CTO Flow Cofounder / ex-CTO Gilt Think about something you deployed recently to production Is It Working? Right now in production? How do you know?

492 views • 33 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail PUBLIC PRESENTATIONS Initial presentation to adjacent property owners in late

505 views • 24 slides
CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
Intro Name : Michael Kck Zoologist, Curator in Haus des Meeres Zoo, Cofounder of the Goodeid

Intro Name : Michael Kck Zoologist, Curator in Haus des Meeres Zoo, Cofounder of the Goodeid

Intro Name : Michael Kck Zoologist, Curator in Haus des Meeres Zoo, Cofounder of the Goodeid Working Group Todays Topic: Redlisting Goodeids for the IUCN, process and shortcommings The talk will be about the Differences between

918 views • 49 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail COMPREHENSIVE PLAN Spokane features three major transportation pathways or

696 views • 25 slides
From days to minutes, from From days to minutes, from minutes to milliseconds with minutes to

From days to minutes, from From days to minutes, from minutes to milliseconds with minutes to

From days to minutes, from From days to minutes, from minutes to milliseconds with minutes to milliseconds with SQLAlchemy SQLAlchemy Leonardo Rochael Almeida 10-July-2019 Hi, Im Leo. Im a Tech Lead at Geru. Im here today to talk

739 views • 54 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
Welcome GMLPN Members Meeting www.gmlpn.co.uk Welcome Richard Nash | GMLPN Welcome

Welcome GMLPN Members Meeting www.gmlpn.co.uk Welcome Richard Nash | GMLPN Welcome

Welcome GMLPN Members Meeting www.gmlpn.co.uk Welcome Richard Nash | GMLPN Welcome www.GMLPN.co.uk Theresa Grant | CEO Trafford Council and GM Area Based Review Chair Andy Fawcett | GMLPN Greater Manchester Work & Skills Update

1.3k views • 81 slides
$ $ $ $ $ $ $ Emily Greer, Co-Founder & COO Data is awesome Data is also a hot mess So

$ $ $ $ $ $ $ Emily Greer, Co-Founder & COO Data is awesome Data is also a hot mess So

Data Gone Wrong Bad Tests,Terrible KPIs and Other Pitfalls $ $ $ $ $ $ $ Emily Greer, Co-Founder & COO Data is awesome Data is also a hot mess So who am I to talk? A shameless data geek! Self-taught, not formally trained: I majored in

517 views • 26 slides
Childhood Obesity London Borough of Hammersmith & Fulham Royal Borough of Kensington &

Childhood Obesity London Borough of Hammersmith & Fulham Royal Borough of Kensington &

Childhood Obesity London Borough of Hammersmith & Fulham Royal Borough of Kensington & Chelsea Westminster City Council November 2015 Purpose of the Childhood Obesity JSNA It: Gathers evidence about childhood obesity, its causes,

414 views • 12 slides
Network Rail Stuart Pountney Commercial Director Northern Progammes 14- 1 Jun / -18

Network Rail Stuart Pountney Commercial Director Northern Progammes 14- 1 Jun / -18

Network Rail Stuart Pountney Commercial Director Northern Progammes 14- 1 Jun / -18 Presentation topics Industry Backdrop & IP Procuring for CP6 Northern Programmes 14-Jun-18 2 / Industry Backdrop passenger growth 90

1.09k views • 75 slides
Q4 and FY 2018 Earnings Review 1 Cautionary ry Note Non-GAAP Measures This presentation of Pan

Q4 and FY 2018 Earnings Review 1 Cautionary ry Note Non-GAAP Measures This presentation of Pan

Q4 and FY 2018 Earnings Review 1 Cautionary ry Note Non-GAAP Measures This presentation of Pan American Silver Corp. and its subsidiaries (collectively, Pan American, Pan American Silver, the Company, we or our)

293 views • 17 slides
Roberts Victor- McCandless Teaching Collection Macrodiamonds develop a distinct set of shapes and

Roberts Victor- McCandless Teaching Collection Macrodiamonds develop a distinct set of shapes and

Roberts Victor- McCandless Teaching Collection Macrodiamonds develop a distinct set of shapes and surface features that relate to their growth in the mantle, and to their resorption in the transporting kimberlite. This collection is designed to

486 views • 12 slides
DOMTAR CORPORATION FOURTH QUARTER 2018 EARNINGS CALL February 5, 2019 (All financial information

DOMTAR CORPORATION FOURTH QUARTER 2018 EARNINGS CALL February 5, 2019 (All financial information

4th QUARTER 2018 EARNINGS CALL | FEBRUARY 5, 2019 DOMTAR CORPORATION FOURTH QUARTER 2018 EARNINGS CALL February 5, 2019 (All financial information is in U.S. dollars, and all earnings per share results are diluted, unless otherwise noted.) 4th

231 views • 19 slides
Oregon Commercial Truck Parking Study Kickoff Oct 2018 Back ckground Movement of goods

Oregon Commercial Truck Parking Study Kickoff Oct 2018 Back ckground Movement of goods

Oregon Commercial Truck Parking Study Kickoff Oct 2018 Back ckground Movement of goods through and in Oregon is vital to the states economy Much of the truck freight moves along the I-5 and I- 84 corridors Truck drivers in

227 views • 7 slides

More recommend