SLIDE 1 ILLUSTRATION BY CINYEE CHIU
Yellow
ver immun uniza ization ion dur uring ing preg egnan nancy cy A mo mous use model del: : gestat station
al perf rform
ance and d viral ral antigen igen distri stribu bution ion in placen acenta ta and d fetuse ses
Estela Bevilacqua
Lab for Research in Maternal-Fetal Interaction & Placenta Dept of Cell and Developmental Biology, Institute of Biomedical Sciences University of São Paulo, SP – SP Brazil
bevilacq@usp.br
SLIDE 2
a) For people living in areas where there is a high potential for YF virus exposure b) For travelers visiting these areas
The benefits of vaccination usually outweigh its potential risks! The yellow fever vaccine should be avoided in pregnant women as far as possible. However, if travel is unavoidable, the
vaccine should be given!
SLIDE 3 The potential risk of viral transmission (through the placenta) to the fetus associated with the possibility of neuroinvasion
virus led to the general recommendation to do not administer the vaccine during pregnancy except when epidemiologically justified.
Popular strategies that disincentive immunization in general!
Vac acci cination tion during ring pregnanc gnancy
No vaccination during pregnancy in endemic areas increases the risk for the disease compromising mother and baby survival
It is imperative to spread knowledge and awareness about the gestational vaccination
SLIDE 4
Abortion, stillbirth and malformation rates after vaccination similar to that found in the general population
Suzano et al., 2006 D’Acremont et al., 2008
Disease risk to a developing fetus from maternal vaccination during pregnancy is primary theoretical!
Vac acci cination tion during ring pregn gnanc ancy
Relative risk for spontaneous abortions Congenital YF Malformation after vaccination in pregnant women
Nishioka et al. 1998 Tsai et al., 1933 Bentlin et al., 2011 Cavalcanti et al., 2007 It is imperative to spread knowledge and awareness about the gestational vaccination!
SLIDE 5 Aim of
this stu tudy
To evaluate the effect of vaccination against yellow fever in mice gestational performance correlating these data with the placental structure, immunolocalization of the virus antigen and the viral activity at the maternal- fetal interface, maternal liver, and fetal
Knowledge to help to demystify vaccination against yellow fever during pregnancy
SLIDE 6 All animal care and experimental procedures were followed according to Brazilian College of Animal Experiments (COBEA) and were approved by the Ethics Committee for Animal Research (CEEA) of Biomedical Sciences Institute of the University of São Paulo, SP.
Animals Pregnant adult, 3-months old, CD-1 mice on 0.5, 5.5, 11.5 and 13.5 gestation days (gd) (n= 10-13/gestational age) Yellow fever 17DD vaccine (parts 00PVFA028Z; 066VFA061Z and 082VFB006Z) Oswaldo Cruz Foundation (Bio-Manguinhos, RJ, Br) Administration - subcutaneous Doses - 2.0 log10 PFU Control group - sterile saline (n=10-11/gestational age) Analysis gd18.5 – euthanasia in CO2 chamber Measurements: number of placentas, early and late resorptions, dead and alive fetuses, implantation sites, fetal and placental weight
Phase se I: To identi ntify fy potenti ential al pregn gnanc ancy phase ses duri ring ng placenta entati tion
anogene enesis sis in in whic ich vaccina natio tion might ght indu duce ce relevant nt changes
SLIDE 7
0.5 gd 1.5 gd
Phase I
Gd 0.5: post-fertilization stage GD 5.5: post-implantation stage
SLIDE 8 Placental barrier
Phase I
http://animalia-life.club/other/mouse-embryo- development-timeline.html / 11 Apr 2019
Gd 11.5 and 13.5: Placenta maturation and fetal organogenesis stage
SLIDE 9 n Implantation sites (no.)
fetuses
stillborn (%) Alive fetuses (%) Fetal Losses Control gd 0.5 71 10.0 ± 1.52 9.79 ±1.15 O.47 ± 0.58 93.8 6.2 Vaccinated gd 0.5 53 10.60 ± 3.71 9.60 ± 4.9 O.38 ± 0.89 94.9 5.1 Control gd 5.5 183 12.29 ± 2.14 12.06 ± 2.27 0.07 ± 0.26 97.8 2.2 Vaccinated gd 5.5 160 12.25 ± 1.92 9.71 ± 2.62 2.32a ± 1.76 74.0 26.0 Control gd 11.5 79 10.37 ± 2.38 9.88 ± 2.23 0.25 ± 0.46 93.9 7.02 Vaccinated gd11.5 61 11.0 ± 2.45 10.25 ±2.99 0.32 ± 0.46 90.9 9.0 Control gd 13.5 82 11.54 ± 1.05 10.28 ± 1.31 0.78 ± 0.53 91.14 8.86 Vaccinated gd13.5 74 10.03 ± 1.94 9.86 ± 2.05 0.54 ± 0.36 89.91 10.09
Effec ect t of anti-yellow ellow fever vaccina natio tion admi minis nister tered d on gestati tion
days 0.5, 5.5, 11.5 and 13.5 on the gestationa tional l parame ameter ters
Values correspond to mean SD; * highlight statistical differences in comparison to the respective age-control.
ap = 0.000 (Student t-test).
Phase I
Significant increase in stillbirth and fetal loss rate when the vaccine is administered on gd5.5
SLIDE 10 Effec ect t of anti-yellow ellow fever vaccina natio tion admi minis nister tered d on gestatio tion n days 0.5, 5.5, 11.5 or 13.5 on placental ental and fetal l weight ghts
Values correspond to mean SD; Values indicated by asterisks highlight statistical differences in comparison to the respective age-control. Student t-test (ap= 0.000; bp=0.0000).
gd5.5 - period of susceptibility to vaccinal yellow fever virus during pregnancy?
Phase I n Fetal weight (g) Placental weight (g) Control gd 0.5 28 0.92 ± 0.20 0.12 ± 0.05 Vaccinated gd 0.5 47 0.88 ± 0.16 0.13 ± 0.02 Control gd 5.5 180 0.89 ± 0.19 0.13 ± 0.03 Vaccinated gd 5.5 151 0.75a± 0.21 0.15b ± 0.06 Control gd 11.5 72 0.84 ± 0.15 0.13 ± 0.09 Vaccinated gd 11.5 41 0.87 ± 0.08 0.13 ± 0.03 Control gd 13.5 72 0.84 ± 0.15 0.13 ± 0.09 Vaccinated gd 13.5 41 0.87 ± 0.08 0.12 ± 0.08
SLIDE 11 Morphologica phological l analy alysis sis
Dead fetuses were macroscopically subdivided into: A - stillbirth (absence
visible degeneration – late fetal death) B - early fetal death (with apparent development delay & degenerative signals) C - post-implantation resorptions (implantation sites with no recognizable fetal structures)
Dead fetuses: macroscopical analysis on gestation day 18.5. Phase I
SLIDE 12 Phase se II: II: Mother hers immuniz unization tion on
gd 5.5. . Identif ntifica cation tion of
al antig igen en distri tribution ution in maternal ernal liver er, , placenta centas s and fetal tal organism anism
Gd 5.5 Gd 18.5 YFV Analyses Post-implantation resorptions (implantation sites with no recognizable fetal structures) Early fetal death (with apparent development delay and degenerative signals) Stillborn puppies (absence of heartbeat, no visible degeneration – late fetal death) Live and apparently healthy fetuses n=25 n=18 Immunolocalization and PCR for yellow fever vaccine virus on the maternal liver and fetal
SLIDE 13 A-C: Maternal and fetal liver – rare areas of reactivity D-F: Immunolocalization
stillborn G-I: Negative controls J: Liver of a patient with YF
Immunolocalization of the yellow fever antigen after vaccination on gd 5.5
Mother Live fetus Stillborn
Liver Stillbirth Controls
Ganglion cells Nerve cells Brain cells
(-) (-) (-) (+)
Phase II
SLIDE 14 Vaccine virus reactivity is scarcely detectable in the organs of alive fetuses but, it is frequent in the tissues of stillbirths (mainly nervous cells) Invasion and colonization of vaccinal YF in tissues of stillbirths
Phase II
0,2 0,4 0,6 0,8
Liver Liver Abdominal region Brain Liver Abdominal region (x10) Brain (x10) Mother Live fetuses Stillborns
% YFV immunoreactivity/histological section (n=5)
0.8 0.6 0.4 0.2 0.0
SLIDE 15
A-D: Placentas from live fetuses Few cells show immunoreactivity to the YF viral antigen (arrowheads) in junctional (A,C) and labyrinth zones (D). E-J: Placentas from stillbirth The reaction is intense in junctional zone (E-F: spongiotrophoblast, G: glycogen cells) and in the labyrinth (H-I) B and J: negative controls
Immunolocalization of the YF antigen after vaccination on gd5.5
Placentas of live fetuses and stillbirth
Live Fetuses Stillbirth
Junctional zone Junctional zone Labyrinth zone
(-) (-)
Labyrinth
Vaccine virus reactivity is largely distributed in numerous placental cells in the stillbirth samples
Phase II
SLIDE 16 177p ACAGCCATTGCCCCAGCCTCTATCAGAATAAGTGCGCTTGCACGCATTGTCCCCTTCGTT 236 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1288v ACAGCCATTGCCCCAGCCTCTATCAGAATAAGTGCGCTTGCACGCATTGTCCCCTTCGTT 1229 237p CTCTTCAGCTAGGTGGGCCTCTCCAGTGCTGGGGCACTTGTCATTAATCTTCACATGAGT 296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1228v CTCTTCAGCTAGGTGGGCCTCTCCAGTGCTGGGGCACTTGTCATTAATCTTCACATGAGT 1169 297p GAGAACTGCATTGTAACACACTTTCCTCGCCTCAGCAGGTCTATCAATGGCTACTGTCTC 356 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1168v GAGAACTGCATTGTAACACACTTTCCTCGCCTCAGCAGGTCTATCAATGGCTACTGTCTC 1109 357p TAGTGAGATGTCCAATGAAGGCTTGTCAGGGGCCATAACAGTGACACACTTGTCTTGCTC 416 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1108v TAGTGAGATGTCCAATGAAGGCTTGTCAGGGGCCATAACAGTGACACACTTGTCTTGCTC 1049 417p CAGGGTA 423 ||||||| 1048v CAGGGTA 1042
Sequencing of the experimental PCR product (from brain of stillborns) and YF vaccine strain 17DD-Brazil showing alignment and 100% identity Database using the BLAST algorithm program
Viral RNA of the capsid protein (465 bp) (A) Very low/no levels detected in maternal liver and fetal tissues of live fetuses (B) Detectable in stillborn tissues
MW: molecular weight ladder mL: maternal liver Pl: placenta (Pl) fB: fetal brain fL: liver Vv: vaccine YF virus (positive control)
Viral RNA is detectable in stillbirth
Phase II
SLIDE 17 In summary…
- 1. Immunization either in post-fertilization phase or during placentation and fetal
- rganogenesis seems not to interfere in gestation progress associated with fetal
viability.
- 2. Changes in gestation performance (increase in stillbirth rate) was seen only
when immunization occurred in the post-implantation phase (gd.5.5).
- 3. In stillborn puppies, YF virus clearly reached the fetal organism -
immunoreactivity to the virus predominated in nervous (neurotropism) and placental tissues; viral RNA was also found in fetal tissues.
- 4. In born-alive fetuses, only scarce YF-immunopositive cells and traces of viral RNA
were found in the fetal tissues.
- 5. Litters of the same female could contain living fetuses and stillborn (increased in
number) when immunization occurred on gd5.5.
- 6. YF virus was found at low levels (traces) in the maternal organism (liver: PCR and
immunoreactions).
To take home…
Immunization during pregnancy showed to be safe. The stage of embryo implantation seems to represent a window of susceptibility in which vaccination and/or associated responses may interfere with the course of gestation. Trophoblast and placenta maturity in late gestational stages may be the key for avoiding congenital passage of the YFV to the fetal organism and/or gestational changes inducing fetal losses.
SLIDE 18
May y trophob phoblas last cells ls play y a criti itical cal role le in the still llbi birth th rates es after er vacci cina nation tion on gd5.5? .5?
Post implantation stage gd5.5
Embryonic barriers to the YF virus on gd5.5 Only a thin layer of TGCs lines the embryo surface TGCs are in the process of differentiation entirely geared towards implanting the embryo in the endometrium
speculating...
SLIDE 19
speculating...
The immaturity of the giant trophoblast cells may allow YFV colonization at placental (ectoplacental cone - EPC) and embryonic (epiblast) stem cell sites (replication), inducing changes that may compromise fetal survival during later stages of gestation.
TGCs open uterine capillaries surrounding the embryo and establish direct contact with maternal blood YFV that reach the maternal circulation can interact directly with TGCs. ?????
SLIDE 20 Li et al., 2008 YF infection in hamster gd5.5 6.5 7.5 8.5 9.5 10.5 11.5 12.5 13.5 15.5 16.5 17.5 18.5 Cytokines slightly elevated Cytokine increases
YF infection is followed by secretion of imune mediators
Cytokine decreases d0 d3 d6 d8 d12 YF vaccine Increased stillbirth rates
Living fetuses
speculating...
Immune une response ponse to to the YFV?
Viremia peaks
Might the prolonged exposure to immune factors determine a harmful response in the litters with subsequent YF viral invasion of fetal tissues? May happen a similar cytokine secretion/variation after immunization? Fetal organisms from mothers vaccinated on gd5.5 would be longer under the action of these cytokines
SLIDE 21 Ongoi
g experi riments ents inclu lude:
- 1. Increase in the frequency of immunizations during the
implantation process.
- 2. YFV localization/activity and cytokine profile in the
embryos/fetuses and placental tissues at different time points after vaccination (temporal dynamics of the response to vaccination in the fetal organism)
- 3. Cytokine kinetics/viremia estimation in the maternal organism at
different time points after vaccination (temporal dynamics of the response to vaccination in the maternal organism)
- 4. In vitro assays using post-implantation TGCs and vaccinal YF to
analyze anti-viral immune defenses in trophoblast cells.
SLIDE 22
Fernanda Carini Fernanda Magaldi Karen Prado Karla Castro Franciele Araujo Aline Lorenzon-Ojea Carla Bandeira Sara Zago Marco Aurelio Amadeo Lab for Research in Maternal-Fetal Interaction & Placenta
ACKNOWLEDGEMENTS
Helena Sato
Immunization Program at the Dept of Health of the State of São Paulo, SP
Claudio Marinho
Institute of Biomedical Sciences, USP
Rossana Francisco Mara S. Hoshida
Medical School-USP, SP-Brazil
Graham Burton Hong Wa Yung
University of Cambridge
Martin Knofler
University of Vienna, Austria
Susan Fisher
University of California, SF, USA
Luana Paulesu Francesca Ietta
University of Siena, Italy
