Splice modulation therapy in inherited retinal diseases Rob Collin - - PowerPoint PPT Presentation

Splice modulation therapy in inherited retinal diseases

Rob Collin

• Dept. of Human Genetics

14th International VHL Medical/Research Symposium October 31st 2020

The eye and inherited retinal diseases (IRDs)

Clinical and genetic heterogeneity of IRD

Retinitis pigmentosa Stargardt disease Leber congenital amaurosis Cone- rod dystrophy Cone dystrophy ACHM

Age

Clinical heterogeneity Genetic heterogeneity

Clinical and genetic heterogeneity of IRD

Retinitis pigmentosa

Stargardt disease Leber congenital amaurosis

Cone- rod dystrophy Cone dystrophy ACHM

Age

Clinical heterogeneity Genetic heterogeneity

Leber congenital amaurosis (LCA)

• Severe and early visual loss (< 12 months)
• Sensory nystagmus
• Subnormal or absent electrical signals on electroretinogram (ERG)
• Amaurotic pupils
• Franceschetti's oculo-digital sign

Amaurotic pupils Nystagmus Oculo-digital sign

Clinical features of LCA

CEP290-associated LCA

CEP290 is a ‘ciliary’ protein that has a specific role in the assembly and maintenance of the (connecting) cilium, in many different (ciliated) cells

CEP290-associated LCA

den Hollander et al. (2006), Am J Hum Genet

CEP290 DNA

Transcription

CEP290 pre-mRNA

Splicing

~50% Incorrect CEP290 CEP290 mRNA

LCA-causing mutation c.2991+1655A>G

~50% Correct CEP290

Aberrant splicing of CEP290

Transcription

CEP290 DNA

Splicing

CEP290 mRNA 100% Correct CEP290

LCA-causing mutation c.2991+1655A>G

AON-based therapy for CEP290-associated LCA

GGGUCAACAUUAACACUCAUA

AON binding CEP290 pre-mRNA

Design AONs Assess AON effect in cultured lymphoblasts from patients

Collin et al. (2012), Mol Ther Nuc Acids

AON-based therapy for CEP290-associated LCA

AON-therapy: ‘naked’ or ‘viral’ ?

3’-GGGUCAACAUUAACACUCAUA-5’

Naked AON AAV-AON

Pro’s:

• ‘easy’ delivery
• no permanent expression
• adjusting dose possible

Cons:

• life long injections

Pro’s:

• single surgery
• long-term expression

Cons:

• side-effects persistent
• partially reaching retina

Garanto et al. (2016), Hum Mol Genet

Rescue in fibroblasts: RNA level

Garanto et al. (2016), Hum Mol Genet

Rescue in fibroblasts: protein level

*p-value<0.05 **p-value<0.01 ***p-value<0.001

Protein levels are significantly increased after AON treatment

Rescue in fibroblasts: ciliation level

Parfitt et al. (2016), Cell Stem Cell

The iPSC – retinal organoid model

Dulla et al. (2018), Mol Ther Nucleic Acids

QR-110 in iPSC-derived retinal organoids

Dulla et al. (2018), Mol Ther Nucleic Acids

QR-110 in iPSC-derived retinal organoids

Results of a phase I/II clinical trial

Stargardt disease (STGD1)

• Progressive disorder, mainly affecting central vision
• Variable age of onset and disease course
• Characterized by ‘flecks’ on autofluorescence imaging
• Caused by bi-allelic mutations in ABCA4

Clinical features of STGD1

ABCA4

ABCA4 protein dysfunction leads to accumulation of waste products (lipofuscin)

Finding genetic causes of STGD1

In 25-30% of STGD1 cases, no or only one ABCA4 allele could be detected 4,000 smMIPs for 128-kb ABCA4 gene

Exon X

1 50 10 20 30 40

110 nt 30-nt linker 20-nt annealing primers

Deep-intronic variants in ABCA4

Mutation Position c.769-784C>T Intron 6 c.859-540C>G Intron 7 c.859-506G>C Intron 7 c.1937+435C>G Intron 13 c.4253+43G>A Intron 28 c.4539+1100A>G Intron 30 c.4539+1106C>T Intron 30 c.4539+2001G>A Intron 30 c.4539+2028C>T Intron 30 c.4539+2064C>T Intron 30 c.5197-557G>T Intron 36 ............ .............

• 1. Are these deep-intronic

variants affecting pre-mRNA splicing, and if so, how?

• 2. Can we do something about it?

Deep-intronic variants in ABCA4

Mutation Position c.769-784C>T Intron 6 c.859-540C>G Intron 7 c.859-506G>C Intron 7 c.1937+435C>G Intron 13 c.4253+43G>A Intron 28 c.4539+1100A>G Intron 30 c.4539+1106C>T Intron 30 c.4539+2001G>A Intron 30 c.4539+2028C>T Intron 30 c.4539+2064C>T Intron 30 c.5197-557G>T Intron 36 ............ .............

• 1. Are these deep-intronic

variants affecting pre-mRNA splicing, and if so, how?

• 2. Can we do something about it?

Splicing modulation for Stargardt disease

A high-throughput assay (c.859-506G>C)

HEK293T cells

Transfection

7 8 9 10 11

Variant of interest

RHO exon 5 RHO exon 3

RT-PCR analysis

Sangermano, Garanto, Khan et al. (2019), Genet Med

Splicing modulation for Stargardt disease

Sangermano, Garanto, Khan et al. (2019), Genet Med

Midigene

Splicing modulation for Stargardt disease

Sangermano, Garanto, Khan et al. (2019), Genet Med

Midigene Fibroblasts

However, n=1

Splicing modulation for Stargardt disease

But sometimes……

M1: c.4539+2001G>A M2: c.4539+2028C>T M1 M2

Albert, Garanto et al. (2018), Am J Hum Genet

Splicing modulation for Stargardt disease

But sometimes……

M1: c.4539+2001G>A M2: c.4539+2028C>T M1 M2

Albert, Garanto et al. (2018), Am J Hum Genet

Splicing modulation for Stargardt disease

Garanto et al. (2019), Genes

Where are we now ?

Discovery

Idea Lead discovery Lead

• ptimiz.

GLP / Tox

• Clin. trial

phase 1

• Clin. trial

phase 2

• Clin. trial

phase 3

Preclinical development Clinical testing CEP290-associated LCA ABCA4-associated IRD Other approaches (genome editing / gene augmentation)

To summarize

• AON-based therapy is a promising therapeutic

approach for IRD

• AONs unfortunately are only applicable to a

subset of mutations

• The (ultra)rarity of some variants requires

creative solutions wrt clinical trial setup

Acknowledgements

Ghent, Ghent University Miriam Bauwens Elfride de Baere Sarah Naessens London, UCL Michael Cheetham David Parfitt ProQR Therapeutics Peter Adamson Kalyan Dulla Jim Swildens Gerard Platenburg Collin & Garanto Lab Alex Garanto Lonneke Duijkers Tomasz Tomkiewicz Nuria Suarez Herrera Irene Vazquez Dominguez Tess Afanasyeva Manon Peeters Anita Hoogendoorn RadboudUMC Silvia Albert Riccardo Sangermano Mubeen Khan Frans Cremers Nathalie Bax Carel Hoyng Saskia van der Velde-Visser Dyon Valkenburg Jeroen Klevering Boston, Mass Eye and Ear Luk Vandenberghe Ru Xiao New York, Columbia Rando Allikmets Winston Lee Philadelphia, Scheie Eye Institute Jean Bennett Daniel Chung Rotterdam, REH Ingeborgh van den Born