University of Cologne Institute of Virology
Should HIV-1 Gag mutations be included in genotypic drug resistance - - PowerPoint PPT Presentation
Should HIV-1 Gag mutations be included in genotypic drug resistance - - PowerPoint PPT Presentation
University of Cologne Institute of Virology Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Jens Verheyen, MD Institute of Virology University of Cologne Triangle: patients - HAART - HIV University of Cologne
University of Cologne Institute of Virology
Triangle: patients - HAART - HIV
HIV-1 antiretroviral treatment patient
University of Cologne Institute of Virology
Duo: HAART - HIV-1
HIV-1 antiretroviral treatment patient
University of Cologne Institute of Virology
Duo: protease inhibitors - protease
protease protease inhibitor patient
University of Cologne Institute of Virology
protease protease inhibitor patient
Triangle: protease inhibitors - protease - substrate
precursor proteins
X X X X X X X X
University of Cologne Institute of Virology
Genotypic HIV-1 drug resistance assays
HIV-1 genome
All routine genotypic resistance tests include: C-terminal gag, the protease, and the reverse transcriptase 2006-2011: 1268 (one HIV-1 genotype per patient) TN HIV-1 without primary resistance: 608 TN HIV-1 with primary resistance: 75 TE HIV-1 with PR mutations: 199 PI failure: 240
University of Cologne Institute of Virology
Treatment naive HIV-1 isolates
E428D, A431VI, K436N, I437V, L449FHV, S451T, R452S, P453AL
Gag CS mutations were significantly correlated with PR mutations Frequency of Gag CS mutations: TN 14% TN+any primary Resistance 20% TN+primary PI Resistance 43% TE+any PR mutation 59% TE+1PR 30% TE+2PR 71% TE+3PR 81% TE+4PR 85% TE+>5PR 79%
University of Cologne Institute of Virology
Summary I:
Gag CS and PR mutations accumulated in PI resistant HIV-1 isolates Gag CS and PR mutations present two sites of the same coin HIV-1 PI resistance
PR mutations Gag CS mutations
University of Cologne Institute of Virology
Gag CS mutations and treatment failure
HIV-1 genotypes were obtained at least 60 days after the start antiretroviral treatment with protease inhibitors (n=240).
PI failure without PR mutations: n=178 (74%) PI failure without PR mutations + Gag CS mutations n=17 (7.4%) PI failure without PR mutations + Gag CS mutations + RT mutations n=6 (2.5%) PI failure (double PI) 1 PR + Gag CS mutations n=2 (0.8%)
University of Cologne Institute of Virology
CS mutations and treatment failure
Intermediate PI resistance level => 1-4 PR mutations => 30-80% Gag CS mutations PR and Gag CS mutations might explain treatment failure
University of Cologne Institute of Virology
Summary II
Protease and Gag CS-mutations are also correlated with PI treatment failure
University of Cologne Institute of Virology
Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should!
University of Cologne Institute of Virology
Genotypic HIV-1 drug resistance assay ABI sequencing kit HIV-1 (Abbott)
University of Cologne Institute of Virology
http://www.geno2pheno.org/
geno2phenogag
>6919 AAGATTGTACTGAGAGACAGGTTAATTTTTTAGGGAAGGTCTGGCC TTCCCACAAAGGAAGGCCAGGGAACTTTTTTCAGACCAGCCTAGAG CCAACAGCCCCACCAGCAGAGAGCTTCATGTTCGGGGGGGAGA
Output (rules based):
- 1. Subtype (Similarity)
- 2. Scoring of PI-related
Gag mutations
- 3. Scoring of mutations
locates in CTL epitopes.
Zur Anzeige wird der QuickTime™ Dekompressor „Grafiken“ benötigt.mainframe xxl mainframe xxl
42
University of Cologne Institute of Virology
Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should! Yes, we can!
University of Cologne Institute of Virology
In the future New sequence technologies HIV-1 whole genome sequencing
University of Cologne Institute of Virology
Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should! Yes, we can! Yes, we will!
University of Cologne Institute of Virology
Thank you!
Institute of Virology, University of Cologne Elena Knops Maria Neumann-Fraune Nadine Lübke Eugen Schülter Claudia Müller Dörte Hammerschmidt Monika Timmen-Wego Saleta Sierra-Aragon Eva Heger Finja Schweitzer Rolf Kaiser Herbert Pfister Daniel Hoffmann Center for Medical Biotechnology, Dominik Heider University of Duisburg-Essen Andre Altmann MPI for Informatics, Saarbrücken Alejandro Pironti Alexander Thielen Thomas Lengauer Gerd Fätkenheuer
- Dept. of Internal Medicine I, University of Cologne
Mark Oette Clinic of General Medicine, Augustinerinnen Hospital Stefan Reuter Clinic of Gastr. Hepat. And Infect Dis., Björn Jenssen University of Duesseldorf