Should HIV-1 Gag mutations be included in genotypic drug resistance - PowerPoint PPT Presentation

University of Cologne Institute of Virology Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Jens Verheyen, MD Institute of Virology University of Cologne

Triangle: patients - HAART - HIV University of Cologne Institute of Virology patient antiretroviral HIV-1 treatment

Duo: HAART - HIV-1 University of Cologne Institute of Virology patient antiretroviral HIV-1 treatment

Duo: protease inhibitors - protease University of Cologne Institute of Virology patient protease protease inhibitor

Triangle: protease inhibitors - protease - substrate University of Cologne Institute of Virology patient protease X X X X protease inhibitor X X X X precursor proteins

Genotypic HIV-1 drug resistance assays University of Cologne Institute of Virology All routine genotypic resistance tests include: C-terminal gag, the protease, and the reverse transcriptase 2006-2011: 1268 (one HIV-1 genotype per patient) TN HIV-1 without primary resistance: 608 TE HIV-1 with PR mutations: 199 TN HIV-1 with primary resistance: 75 PI failure: 240 HIV-1 genome

Treatment naive HIV-1 isolates University of Cologne Institute of Virology Gag CS mutations were significantly correlated with PR mutations E428D, A431VI, K436N, I437V, L449FHV, S451T, R452S, P453AL Frequency of Gag CS mutations: TN 14% TN+any primary Resistance 20% TN+primary PI Resistance 43% TE+any PR mutation 59% TE+1PR 30% TE+2PR 71% TE+3PR 81% TE+4PR 85% TE+>5PR 79%

Summary I: University of Cologne Institute of Virology Gag CS and PR mutations accumulated in PI resistant HIV-1 isolates Gag CS and PR mutations present two sites of the same coin HIV-1 PI resistance Gag CS PR mutations mutations

Gag CS mutations and treatment failure University of Cologne Institute of Virology HIV-1 genotypes were obtained at least 60 days after the start antiretroviral treatment with protease inhibitors (n=240). PI failure without PR mutations: n=178 (74%) PI failure without PR mutations + Gag CS mutations n=17 (7.4%) PI failure without PR mutations + Gag CS mutations + RT mutations n=6 (2.5%) PI failure (double PI) 1 PR + Gag CS mutations n=2 (0.8%)

CS mutations and treatment failure University of Cologne Institute of Virology Intermediate PI resistance level => 1-4 PR mutations => 30-80% Gag CS mutations PR and Gag CS mutations might explain treatment failure

Summary II University of Cologne Institute of Virology Protease and Gag CS-mutations are also correlated with PI treatment failure

University of Cologne Institute of Virology Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should!

Genotypic HIV-1 drug resistance assay ABI sequencing kit HIV-1 (Abbott) University of Cologne Institute of Virology

http://www.geno2pheno.org/ geno2pheno gag University of Cologne Institute of Virology >6919 AAGATTGTACTGAGAGACAGGTTAATTTTTTAGGGAAGGTCTGGCC TTCCCACAAAGGAAGGCCAGGGAACTTTTTTCAGACCAGCCTAGAG CCAACAGCCCCACCAGCAGAGAGCTTCATGTTCGGGGGGGAGA Output (rules based): mainframe mainframe 1. Subtype (Similarity) xxl xxl Zur Anzeige wird der QuickTime™ Dekompressor „Grafiken“ benötigt. 2. Scoring of PI-related Gag mutations 42 3. Scoring of mutations locates in CTL epitopes.

University of Cologne Institute of Virology Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should! Yes, we can!

In the future University of Cologne Institute of Virology New sequence technologies HIV-1 whole genome sequencing

University of Cologne Institute of Virology Should HIV-1 Gag mutations be included in genotypic drug resistance scores? Yes, we should! Yes, we can! Yes, we will!

Thank you! University of Cologne Institute of Virology Daniel Hoffmann Center for Medical Biotechnology, Dominik Heider University of Duisburg-Essen Andre Altmann MPI for Informatics, Saarbrücken Alejandro Pironti Alexander Thielen Thomas Lengauer Gerd Fätkenheuer Dept. of Internal Medicine I, University of Cologne Mark Oette Clinic of General Medicine, Augustinerinnen Hospital Stefan Reuter Clinic of Gastr. Hepat. And Infect Dis., Björn Jenssen University of Duesseldorf Institute of Virology, University of Cologne Elena Knops Maria Neumann-Fraune Nadine Lübke Eugen Schülter Claudia Müller Dörte Hammerschmidt Monika Timmen-Wego Saleta Sierra-Aragon Eva Heger Finja Schweitzer Rolf Kaiser Herbert Pfister