Quantitatively deconvolving alternative RNA secondary structures - PowerPoint PPT Presentation

Quantitatively deconvolving alternative RNA secondary structures Regina Bohnert and Gunnar R¨ atsch Friedrich Miescher Laboratory of the Max Planck Society T¨ ubingen, Germany July 15, 2011 HiTSeq-SIG, ISMB/ECCB 2011

Introduction Motivation RNA Secondary Structure and Its Role fml ◮ RNA-seq: transcript intron identification with pre-mRNA quantitation exon ◮ But: information about structure is missing ◮ Important role in basic mRNA cellular processes short reads junction reads reference genome Figure adapted from Wikipedia Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 1 / 13

Introduction Motivation RNA Secondary Structure and Its Role fml ◮ RNA-seq: transcript identification with quantitation ◮ But: information about structure is missing ◮ Important role in basic cellular processes ◮ Regulation of gene expression Trp operon, figure taken from Wikipedia Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 1 / 13

Introduction Motivation RNA Secondary Structure and Its Role fml ◮ RNA-seq: transcript identification with quantitation ◮ But: information about structure is missing ◮ Important role in basic cellular processes ◮ Regulation of gene expression, alternative splicing ◮ Mixtures of alternative structures may co-exist TPP riboswitch, figure taken from Wachter (2010) Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 1 / 13

Introduction PARS Protocol Profiling RNA Secondary Structures fml mRNA 5’ cap AAAAAA In vitro folding S1 a b RNase V1 digestion S1 nuclease digestion V1 5’P 5’P Random fragmentation Random fragmentation 5’ OH 5’ OH 5’P 5’P Library preparation Library preparation deep sequencing deep sequencing V1 pro le S1 pro le Number of reads AGGCAUGCACCUGGUAGCUAGUCUUUAAACC … AGGCAUGCACCUGGUAGCUAGUCUUUAAACC … PARS (parallel analysis of RNA structure) protocol, figure taken from (Kertesz et al., 2010) Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 2 / 13

Structure Quantitation with sQuant Bias Bias Correction fml ◮ Observation: no uniform distribution (Kertesz et al., 2010) ◮ Data simulation read counts ◮ Simulated structures (Hofacker et al., 1994) ◮ Generated read counts for transcript position ds/ss experiments (PARS-like) # " " ! " " " " ◮ Read starts at ds/ss ! " $ # ! $ " " $ ! $ " " " $ " $ # ! $ $ $ $ " ! # " $ $ # $ " $ " " " " ! " " $ " $ $ " "" "! # # " " " $ $ $ # # ! " $ # " " # $ $ $ # without noise $ ! " $ ! $ $ $ " $ $ # $ $ # # ! $ " $ $ $ $ ! " " # " # $ " $ $ !#"" ! ! # ! " $ # $ " " # " " " " ! $ " ! after digestion $ $ $ ! " " " " " $ " ◮ Enzyme errors " $ ! " # $ " $ $ after fragm. + $ " " $ $ " ! " $ size selection ◮ Fragmentation, size !!!!"""""""!!""!!!!""""!!""!"!!!!!!#!##!!!####!##!!#######!!!!!!""""!!!!!"""""""!!!!!!""""!!!!!####!!!!!!!!!!""""""""!!!!!!!########!!!!!!!!###!####!!####!!!!!!!!! % selection Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 3 / 13

Structure Quantitation with sQuant Bias Bias Correction fml ◮ Observation: no uniform distribution (Kertesz et al., 2010) ◮ Data simulation read counts ◮ Simulated structures (Hofacker et al., 1994) ◮ Generated read counts for transcript position ds/ss experiments (PARS-like) # " " ! " " " " ! " $ # ! $ " " $ ! $ " " " $ " $ # ! $ $ $ $ " ! # " $ $ # $ " $ " " " " ! " " $ " $ $ " "" "! # # " " " $ $ $ # # ! " $ # " " # $ $ $ ! # simulated $ ! " $ $ $ $ " $ $ # $ $ # # ! $ " $ $ $ $ ! " " # " # $ " $ $ !#"" ! ! # ! " $ # $ " " # " " " " ! $ " ! predicted $ $ $ ! " " " " " $ " ◮ Bias correction: Ridge regression " $ ! " # $ " $ $ $ " " $ $ " ! " $ !!!!"""""""!!""!!!!""""!!""!"!!!!!!#!##!!!####!##!!#######!!!!!!""""!!!!!"""""""!!!!!!""""!!!!!####!!!!!!!!!!""""""""!!!!!!!########!!!!!!!!###!####!!####!!!!!!!!! ◮ Features: distances to proximal cutting sites ◮ Target: expected/observed read counts ◮ Model explains ≈ 75% of the variability Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 3 / 13

Structure Quantitation with sQuant Quantitation Questions fml ◮ How can known transcripts with structural information be quantified? ◮ Single transcript with multiple possible structures ◮ Alternative transcripts with multiple possible structures ◮ How can structures be inferred from read data? Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 4 / 13

Structure Quantitation with sQuant Quantitation sQuant – Basic Idea fml ! " " $ " $ " # ! " $ " $ $ $ " # ! $ $ " " "" "! # # " $ $ $ ! $ $ " " $ " ! $ " ! # " " $ $ $ # # ! " $ # # " " $ " # " $ " " " " " Structure A " " $ $ # $ " ! " # " " ! $ $ " $ # ! !#"" ! ! # ! " $ # ! $ $ $ " " # " $ $ " ! $ ! " $ " # " # $ ! " $ $ $ $ $ $ ! " " # " # $ $ read counts ds " " " $ " $ $ " $ ! " $ " $ $ # " $ $ " " " $ $ ! " " $ !!!!"""""""!!""!!!!""""!!""!"!!!!!!#!##!!!####!##!!#######!!!!!!""""!!!!!"""""""!!!!!!""""!!!!!####!!!!!!!!!!""""""""!!!!!!!########!!!!!!!!###!####!!####!!!!!!!!! Mixture of structures w A ss read counts ds transcript position 5’ -> 3’ ss w B " " ! " transcript position 5’ -> 3’ " $ " $ $" $ $ " "" " ! # $ # ! # ! $ $ $ " $ $ # " $ " " $ $ " $ ! $ " " " " " Structure B $ # # " ! # $ " " !" $ # " $ " # " $ " # ! " " " " " " ! $ $ ! " # $ $ $ # # " ! ! # ! " # $ ! $ " " ! ! # " # $ ! $ " $ $ " " $ " # " # $ $ $ $ " " $ " $ $ " ! read counts ds " $ $ $ $ $ ! "" $ $ " " # " " $ $ # # ! $ " " $ " $ $ " $ ! " !""""!!!""""""!!""""!!!"""!"""!!!!!!!###!###!!!####!##!####!!####!!!!!!!!""""""!"""""!!!!!!!!#####!!!!"""""!!"""""!""""!!!!#########!!#!####!##!####!!!!!!!!!!!!!!! " ! $ " $ A B C ss transcript position 5’ -> 3’ Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 5 / 13

Structure Quantitation with sQuant Quantitation Recap from Transcript Quantitation fml rQuant (Bohnert et al., 2009; Bohnert and R¨ atsch, 2010) Short transcript read coverage Mixture of transcripts w A read coverage genome position 5’ -> 3’ expected observed Long transcript w B read coverage genome position 5’ -> 3’ A M B C genome position 5’ -> 3’ M p = w A A p + w B B p min w A , w B � p ℓ ( M p , C p ) ⇒ Regina Bohnert (FML, T¨ ubingen) Secondary structure quantitation Jul 15, 2011 6 / 13