monte carlo simulation
play

Monte Carlo Simulation GATE (6.x & 7) Geant4 (4.9 & 4.10) - PowerPoint PPT Presentation

Aug 20, 2023 •108 likes •162 views

Monte Carlo Simulation GATE (6.x & 7) Geant4 (4.9 & 4.10) Analysis Code (MCNP) - 272 Cores / 76TB 177 Lu GATE 6.2 Geant 4.10 Exp 90 Y Bremsstrahlung Imaging Geant4 MCNP HPGe Exp 90Y Anthropomorphic Dose Validation Thanks A.

  1. Monte Carlo Simulation GATE (6.x & 7) Geant4 (4.9 & 4.10) Analysis Code (MCNP) - 272 Cores / 76TB 177 Lu GATE 6.2 Geant 4.10 Exp 90 Y Bremsstrahlung Imaging Geant4 MCNP HPGe Exp 90Y

  2. Anthropomorphic Dose Validation

  3. Thanks A. P. Robinson, D. M. Cullen, R. Brown, A. Flynn, C. Oldfield, D. Rawlinson and A. Smith Nuclear Physics Group, The University of Manchester J. Tipping, D. Hamilton and E. Page Christie Medical Physics and Engineering, The Christie NHS Foundation Trust

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Simulation Monte Carlo Monte Carlo simulation Outcome of a single stochastic simulation run

Simulation Monte Carlo Monte Carlo simulation Outcome of a single stochastic simulation run

Simulation Monte Carlo Monte Carlo simulation Outcome of a single stochastic simulation run is always random A single instance of a random variable Goal of a simulation experiment is to get knowledge about the distribution of the

427 views • 18 slides
QUASI-EQUILIBRIUM MONTE-CARLO: OFF-LATTICE KINETIC MONTE CARLO SIMULATION OF HETEROEPITAXY

QUASI-EQUILIBRIUM MONTE-CARLO: OFF-LATTICE KINETIC MONTE CARLO SIMULATION OF HETEROEPITAXY

QUASI-EQUILIBRIUM MONTE-CARLO: OFF-LATTICE KINETIC MONTE CARLO SIMULATION OF HETEROEPITAXY WITHOUT SADDLE POINTS Henry A. Boateng University of Michigan, Ann Arbor Joint work with Tim Schulze and Peter Smereka Support from NSF FRG grant

609 views • 30 slides
1 Simple example of simulation Slide 4 Evaluation of expected value of production E(V)

1 Simple example of simulation Slide 4 Evaluation of expected value of production E(V)

(Monte Carlo) Simulation (Monte Carlo) Simulation Slide 1 What is simulation? Simulation is an attempt to model a real world system in order to: Obtain a better understanding of the system (including interactions) Physiological

376 views • 8 slides
Monte Carlo Simulation technique S. B. Santra Department of Physics Indian Institute of

Monte Carlo Simulation technique S. B. Santra Department of Physics Indian Institute of

Monte Carlo Simulation technique S. B. Santra Department of Physics Indian Institute of Technology Guwahati Introduction What is Monte Carlo (MC)? Monte Carlo method is a common name for a wide variety of stochastic techniques. These

3.05k views • 48 slides
Basics of Monte Carlo Simulation condensed from a presentation by M. Asai Dennis Wright Geant4

Basics of Monte Carlo Simulation condensed from a presentation by M. Asai Dennis Wright Geant4

Basics of Monte Carlo Simulation condensed from a presentation by M. Asai Dennis Wright Geant4 Tutorial at Lund University 3 September 2018 Contents Historical review of Monte Carlo methods Basics of Monte Carlo method probability

843 views • 40 slides
Fast Monte-Carlo Simulation of Ion Implantation Binary Collision Approximation Implementation

Fast Monte-Carlo Simulation of Ion Implantation Binary Collision Approximation Implementation

Fast Monte-Carlo Simulation of Ion Implantation Binary Collision Approximation Implementation within ATHENA Contents Simulation Challenges for Future Technologies Monte-Carlo Concepts and Models Atomic and nuclear

267 views • 26 slides
Barrier Option Pricing Introduction Barrier Options and Monte Carlo Simulations The

Barrier Option Pricing Introduction Barrier Options and Monte Carlo Simulations The

Monte Carlo Simulations Jessica Radeschnig Barrier Option Pricing Introduction Barrier Options and Monte Carlo Simulations The Discretized A Monte Carlo Simulation Approach Black-Scholes Model Simulation The Algorithm Example

473 views • 11 slides
3. Monte Carlo Simulations Understanding Molecular Simulation Molecular Simulations Molecular

3. Monte Carlo Simulations Understanding Molecular Simulation Molecular Simulations Molecular

3. Monte Carlo Simulations Understanding Molecular Simulation Molecular Simulations Molecular dynamics : solve equations of motion r 1 r 2 r n Monte Carlo : importance sampling r 1 r 2 r n Understanding Molecular Simulation Monte Carlo

1.02k views • 50 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents 3 4 CONTENTS Part I Simulation and Monte-Carlo Integration 5 Chapter 1 Simulation and Monte-Carlo

876 views • 65 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents 3 4 CONTENTS Part I Simulation and Monte-Carlo Integration 5 Chapter 1 Simulation and Monte-Carlo

346 views • 23 slides
4. THE MONTE CARLO METHOD 4.1 I ntroduction This chapter is aimed at describing the Monte Carlo

4. THE MONTE CARLO METHOD 4.1 I ntroduction This chapter is aimed at describing the Monte Carlo

C hapter 4: Monte Carlo Modeling of Grain Growth and Recrystallization, A.D. Rollett & P. Manohar 4. THE MONTE CARLO METHOD 4.1 I ntroduction This chapter is aimed at describing the Monte Carlo method for the simulation of grain growth and

2.05k views • 37 slides
Estimating Financial Risk through Monte Carlo Simulation Modeling Value at Risk (VaR) with

Estimating Financial Risk through Monte Carlo Simulation Modeling Value at Risk (VaR) with

Estimating Financial Risk through Monte Carlo Simulation Modeling Value at Risk (VaR) with Linear Regression Under Normal Distribution Assumption Outline - What Are We Getting Into? - Basic Terms - Monte Carlo Risk Modeling - Results /

1.46k views • 41 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents I Simulation and Monte-Carlo Integration 5 1 Simulation and Monte-Carlo integration 7 1.1 Issues in

880 views • 51 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents I Simulation and Monte-Carlo Integration 5 1 Simulation and Monte-Carlo integration 7 1.1 Issues in

195 views • 17 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents I Simulation and Monte-Carlo Integration 5 1 Simulation and Monte-Carlo integration 7 1.1 Issues in

878 views • 58 slides
Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by

Monte Carlo Methods Lecture notes for MAP001169 Based on Script by Martin Sk old adopted by Krzysztof Podg orski 2 Contents I Simulation and Monte-Carlo Integration 5 1 Simulation and Monte-Carlo integration 7 1.1 Issues in

548 views • 20 slides
Hardware development for TDAQ based on xTCA Jingzhou ZHAO 1 , Zhen-An LIU 1 , Wenxuan GONG 1 ,

Hardware development for TDAQ based on xTCA Jingzhou ZHAO 1 , Zhen-An LIU 1 , Wenxuan GONG 1 ,

Hardware development for TDAQ based on xTCA Jingzhou ZHAO 1 , Zhen-An LIU 1 , Wenxuan GONG 1 , Pengcheng CAO 1 , Wolfgang Kuehn 2 Trigger Lab, Institute of High Energy Physics, Chinese Academy of Sciences 1. II. Physikalisches Institut,

750 views • 20 slides
Social Media in Survey Research Casey Langer Tesfaye American Institute of Physics AAPOR 69 th

Social Media in Survey Research Casey Langer Tesfaye American Institute of Physics AAPOR 69 th

Reporting Data in the Social Media World Panel Title: Practical Applications for Social Media in Survey Research Casey Langer Tesfaye American Institute of Physics AAPOR 69 th Annual Conference 5/16/2014 2 Problem It has always been

628 views • 46 slides
Industrial Mathematics: One Industrial Mathematics: One Canadian Perspective Canadian

Industrial Mathematics: One Industrial Mathematics: One Canadian Perspective Canadian

Industrial Mathematics: One Industrial Mathematics: One Canadian Perspective Canadian Perspective (Part 3) (Part 3) Matt Davison Canada-China Workshop in Industrial Math, BIRS, August 2007 Range of Projects with industrial collaborators

586 views • 22 slides
Maria Baker Academic Squabble This is my talk. I like to start with a joke. Why are goose

Maria Baker Academic Squabble This is my talk. I like to start with a joke. Why are goose

Maria Baker Academic Squabble This is my talk. I like to start with a joke. Why are goose terrible drivers? Because they honk all the time. Today Im going to talk about Academic Squabble Academic Squabble is a card game Academic Squabble

659 views • 54 slides
Spack: Bringing Order to HPC Software Chaos Scalable Tools Workshop 2015 August 3, 2015

Spack: Bringing Order to HPC Software Chaos Scalable Tools Workshop 2015 August 3, 2015

Spack: Bringing Order to HPC Software Chaos Scalable Tools Workshop 2015 August 3, 2015 http://bit.ly/spack-git Contributors Matt Legendre Greg Lee Mike Collette Bronis de Supinski Scott Futral LLNL-PRES-675781 This work was performed

622 views • 26 slides
Thesis: We will never really understand learning until we build machines that learn many

Thesis: We will never really understand learning until we build machines that learn many

Never Ending Language Learning Tom M. Mitchell Machine Learning Department Carnegie Mellon University Thesis: We will never really understand learning until we build machines that learn many different things, from years of diverse

427 views • 41 slides
ADR Customization Interface Joel Saltz Alan Sussman Tahsin Kurc University of Maryland, College

ADR Customization Interface Joel Saltz Alan Sussman Tahsin Kurc University of Maryland, College

ADR Customization Interface Joel Saltz Alan Sussman Tahsin Kurc University of Maryland, College Park and Johns Hopkins Medical Institutions http://www.cs.umd.edu/projects/adr Data Loading Service Provides support for loading datasets

912 views • 47 slides
Appetizer: Simultaneous Translation ACL 2019 Invited Talk Simultaneous Translation: Recent

Appetizer: Simultaneous Translation ACL 2019 Invited Talk Simultaneous Translation: Recent

LinearFold: Linear-Time Parsing Meets RNA Folding x GCGGGAAUAGCUCAGUUGGUAGAGCACGACCUUGCCAAGGUCGGGGUCGCGAGUUCGAGUCUCGUUUCCCGCUCCA y (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... 1 G C U C C A C G G C 70

1.29k views • 108 slides

More recommend