Lucrative Healthcare Fields That Don't End With MD, DDS, PhD, PA, - - PowerPoint PPT Presentation

Lucrative Healthcare Fields That Don't End With MD, DDS, PhD, PA, PT, PharmD

Peter Hu, PhD, FACSc

School of Health Professions

Conflict of Interest

 Nothing to declare

School of Health Professions

 Are you hoping to get a full-time job related to

your degree right after college?

 If you have incurred debt or have student loans,

do you have a plan on how to pay them back after graduation?

 If you don’t get into the program you wanted

afterwards what is your plan “B” or “C…”

Questions to ask your students

School of Health Professions

What to take way from the Statistics: Challenges for Today’s College Graduates

 Inflation of education: rising tuition costs

nationwide

 Current economic challenges of the job

market:

• Unemployed college students ?
• Underemployed college students ?

 Students taking longer than four years to

complete a bachelors degree

 Students accruing more debt in both credit

and student loans that the percentage of defaulting is on the rise

Allied Health Degree Programs in Laboratory & Radiological Sciences

POSSIBLE SOLUTION?

School of Health Professions

Characteristics

 Are problem solvers

• Logical
• Critical thinkers

 Like challenge and responsibility  Are accurate and reliable  Work well under pressure  Communicate well  Set high standards for themselves  Are fascinated by disease

School of Health Professions

Key Role

 Essential members of the health care

team

 Up to 75% of physician decisions

regarding patient diagnosis and therapy are based on test results

 Modern medicine could not function

without clinical laboratory professionals

School of Health Professions

General Clinical Laboratory Science

School of Health Professions

Clinical Laboratory Scientist

 Examine and

count blood cells to detect abnormalities found in anemias, leukemias and infections so appropriate therapy can be started

School of Health Professions

Clinical Laboratory Scientist

 Detect and identify

disease-causing bacteria and parasites

 Determine the

best antibiotics to use for bacterial infections

School of Health Professions

Clinical Laboratory Scientist

 Analyze body fluids for

many diverse proteins, sugars, enzymes, lipids, hormones and drugs

 Provide information to

physicians to help diagnose

• Cancer
• Diabetes and kidney disease
• Drug overdoses
• And many other conditions…

Clinical Laboratory Scientist

 Determine blood

types

 Provide compatible

unit transfusion

 Prepare stem cells

School of Health Professions

Cytotechnology

School of Health Professions

Key Role

 Study cellular changes at the microscopic

level to detect and diagnose disease

 Work with pathologists and physicians to

play a significant role in the diagnosis and treatment of cancer and other diseases

 Detect disease early when treatment is

most effective

School of Health Professions

Cytotechnologists

 Examine human

cell samples using the light microscope

 Makes judgmental

decision as to what is normal and abnormal

School of Health Professions

Histotechnology

School of Health Professions

Key Role

 Apply biological and chemical

techniques used in the preparation of tissue samples for microscopic evaluation

 Experts in sectioning and

staining tissues

 Work closely with pathologists

in the analysis of cellular clues, which provide essential information needed for disease treatment and diagnosis

School of Health Professions

Team Pathology

 Members of the surgical pathology team  The goal of the Pathology Team is to prepare

and analyze tissue to provide a life-saving diagnosis for the patient

School of Health Professions

Cytogenetic Technology

School of Health Professions

Key Role

 Study cell division and the structure of

chromosomes as applied to the diagnosis and monitoring of acquired and inherited abnormalities

 Identify chromosomal abnormalities to

detect and treat genetic diseases

School of Health Professions

Numerical and Structural Chromosome abnormality will cause genetic disease and cancer

Chronic Myelogenous Leukemia Down Syndrome

School of Health Professions

Chromosomal Clues

Study chromosomes or genes using conventional and molecular cytogenetic and cytogenomic techniques with the latest computer imaging technology

School of Health Professions

Clinical Applications

 Prenatal Testing

• Reason for miscarriage
• Genetic risks for baby

 Postnatal Testing

• Mental retardation
• Developmental retardation
• Gender identification

 Cancer Cytogenetics

• Cancer diagnosis and differential

diagnosis

• Determine prognosis & clinical

trials

Molecular Genetic Technology

School of Health Professions

Key Role

Clinical laboratory specialty that studies the role of genetics (DNA/RNA/Protein) to discover the relationship between genetics and personal health or identity

• Different people have slightly different genomes: all humans

share 99.9% of the same genetic code.

• The 0.1% difference accounts for height,

eye color, high cholesterol susceptibility, etc.

What Is Genome Sequencing?

CTGATGATGGACTACGCTACTACTGCTAGCTGTATTACGA TCAGCTACCACATCGTAGCTACGATGCATTAGCAAGCTAT CGATCGATCGATCGATTATCTACGATCGATCGATCGATCA CTATACGAGCTACTACGTACGTACGATCGCGGGACTATTA TCGACTACAGATAAAACATGCTAGTACAACAGTATACATA GCTGCGGGATACGATTAGCTAATAGCTGACGATATCCGAT CTGATGATGGACTACGCTACTACTGCTAGCTGTATTACGA TCAGCTACAACATCGTAGCTACGATGCATTAGCAAGCTAT CGATCGATCGATCGATTATCTACGATCGATCGATCGATCA CTATACGAGCTACTACGTACGTACGATCGCGTGACTATTA TCGACTACAGATGAAACATGCTAGTACAACAGTATACATA GCTGCGGGATACGATTAGCTAATAGCTGACGATATCCGAT

School of Health Professions

How?

• 1. Sample Extraction
• 2. Sample Quantification
• 3. Genetic Testing

PCR DNA Sequencing NGS

• 4. Data Analysis

School of Health Professions

2010 2020 2030 Predictive genetic tests available for a dozen conditions Gene-based designer drugs for diabetes, hypertension, etc., Comprehensive genomics-based health care is the norm Interventions to reduce risk available Cancer therapy is precisely targeted to DNA of tumor Illnesses are detected early by molecular surveillance

Molecular Genetics Technology: Projections in the field of Healthcare Why hy Molecu Molecular lar Gene enetic ic Tec echnolog hnology? y?

• Making a dif

Making a differ erence ence

• Wor
• rking with cut

king with cutting ing edge edge tec echno hnolog logy

• Applica

pplications ions of

• f

In Infor

• rma

matics ics

• Evolving field
• lving field

Radiologic Sciences

Diagnostic Imaging

School of Health Professions

Key Role

 Diagnostic Imaging is a specialty devoted to the

study of routine and advanced radiographic imaging procedures

 Prominent members of the health care team

focused on the diagnosis and treatment of human disease

 Specializations in the senior year

• CT
• MRI
• Education
• Management
• Diagnostic Medical Sonography

School of Health Professions

Computed Tomography (CT)

 Utilizes ionizing

radiation to produce cross-sectional images of the body

CT & Interventional Radiology Emphasis

Used to treat blockages inside arteries and veins, to shut off blood to vessels that nourish tumors, and destroy malignant tumors

Magnetic Resonance Imaging (MRI)

Uses strong magnetic field and radio waves to create detailed images of the body

School of Health Professions

Diagnostic Medical Sonography

School of Health Professions

Key Role

 A Sonographer is

highly-skilled professional who uses ultrasound equipment to create images of structures inside the human body, used for diagnosis

School of Health Professions

Areas of Emphasis

 Abdomen  Breast  Fetal Echocardiography  Neurosonography  Obstetrics/Gynecology

School of Health Professions

Educational Structure

• Didactic
• Normal anatomy
• Pathology
• Visual pattern recognition
• Teach you how to scan
• Technical
• Visual pattern recognition
• Patient Care
• Communication with patients

and staff

School of Health Professions

Medical Dosimetry

School of Health Professions

Key Role

 Members of the radiation oncology team.  Create treatment plans for radiation therapy of cancer

patients with the goal of destroying the cancerous cells while minimizing the radiation to the surrounding healthy tissues.

School of Health Professions

Medical Dosimetrists

SPARE

Prostate Cancer

Courtesy of Dr. Peter Balter

School of Health Professions

Medical Dosimetrists

 Have the knowledge of

anatomy, radiation physics and biology, math, computer, and treatment planning.

 Perform radiation dose

calculations.

 Involved with quality

assurance activities to ensure proper treatment

• f patients.

School of Health Professions

Medical Dosimetrists

 Have the knowledge of anatomy, radiation physics, math,

computer, and treatment planning.

 Perform radiation dose calculations using sophisticated

treatment planning computers.

 Students learn the required skills in the two year program

that include classroom, laboratory, and clinical education.

School of Health Professions

Radiation Therapy

School of Health Professions

 A clinical specialty dealing with the use of

Ionizing radiation in the treatment of malignant tumors or associated disorders

 Goal: To deliver a precisely measured

treatment to a defined tumor volume with as little damage as possible to surrounding normal tissue

What is Radiation Therapy?

School of Health Professions

School of Health Professions

RT (T) Scope of Practice

 Radiation

Therapist is an integral part of the health care team

• Plan
• Deliver
• Record
• Monitor

School of Health Professions

How to get in?

 Upper undergraduate level programs

• Must take prerequisite courses elsewhere

 Accredited programs  Competitive GPA – above 3.0

School of Health Professions

Entry Salary Range

$45,000 - $75,000 Five Year Average $55,000 - $100,000+

School of Health Professions

QUESTIONS?