Lucrative Healthcare Fields That Don't End With MD, DDS, PhD, PA, - PowerPoint PPT Presentation

Lucrative Healthcare Fields That Don't End With MD, DDS, PhD, PA, PT, PharmD Peter Hu, PhD, FACSc

Conflict of Interest  Nothing to declare School of Health Professions

Questions to ask your students  Are you hoping to get a full-time job related to your degree right after college?  If you have incurred debt or have student loans, do you have a plan on how to pay them back after graduation?  If you don’t get into the program you wanted afterwards what is your plan “B” or “C…” School of Health Professions

What to take way from the Statistics: Challenges for Today’s College Graduates  Inflation of education: rising tuition costs nationwide  Current economic challenges of the job market: ◦ Unemployed college students ? ◦ Underemployed college students ?  Students taking longer than four years to complete a bachelors degree  Students accruing more debt in both credit and student loans that the percentage of defaulting is on the rise School of Health Professions

POSSIBLE SOLUTION? Allied Health Degree Programs in Laboratory & Radiological Sciences

Characteristics  Are problem solvers ◦ Logical ◦ Critical thinkers  Like challenge and responsibility  Are accurate and reliable  Work well under pressure  Communicate well  Set high standards for themselves  Are fascinated by disease School of Health Professions

Key Role  Essential members of the health care team  Up to 75% of physician decisions regarding patient diagnosis and therapy are based on test results  Modern medicine could not function without clinical laboratory professionals School of Health Professions

General Clinical Laboratory Science School of Health Professions

Clinical Laboratory Scientist  Examine and count blood cells to detect abnormalities found in anemias, leukemias and infections so appropriate therapy can be started School of Health Professions

Clinical Laboratory Scientist  Detect and identify disease-causing bacteria and parasites  Determine the best antibiotics to use for bacterial infections School of Health Professions

Clinical Laboratory Scientist  Analyze body fluids for many diverse proteins, sugars, enzymes, lipids, hormones and drugs  Provide information to physicians to help diagnose ◦ Cancer ◦ Diabetes and kidney disease ◦ Drug overdoses ◦ And many other conditions… School of Health Professions

Clinical Laboratory Scientist  Determine blood types  Provide compatible unit transfusion  Prepare stem cells

Cytotechnology School of Health Professions

Key Role  Study cellular changes at the microscopic level to detect and diagnose disease  Work with pathologists and physicians to play a significant role in the diagnosis and treatment of cancer and other diseases  Detect disease early when treatment is most effective School of Health Professions

Cytotechnologists  Examine human cell samples using the light microscope  Makes judgmental decision as to what is normal and abnormal School of Health Professions

Histotechnology School of Health Professions

Key Role  Apply biological and chemical techniques used in the preparation of tissue samples for microscopic evaluation  Experts in sectioning and staining tissues  Work closely with pathologists in the analysis of cellular clues, which provide essential information needed for disease treatment and diagnosis School of Health Professions

Team Pathology  Members of the surgical pathology team  The goal of the Pathology Team is to prepare and analyze tissue to provide a life-saving diagnosis for the patient School of Health Professions

Cytogenetic Technology School of Health Professions

Key Role  Study cell division and the structure of chromosomes as applied to the diagnosis and monitoring of acquired and inherited abnormalities  Identify chromosomal abnormalities to detect and treat genetic diseases School of Health Professions

Numerical and Structural Chromosome abnormality will cause genetic disease and cancer Down Syndrome Chronic Myelogenous Leukemia School of Health Professions

Chromosomal Clues Study chromosomes or genes using conventional and molecular cytogenetic and cytogenomic techniques with the latest computer imaging technology School of Health Professions

Clinical Applications  Prenatal Testing ◦ Reason for miscarriage ◦ Genetic risks for baby  Postnatal Testing ◦ Mental retardation ◦ Developmental retardation ◦ Gender identification  Cancer Cytogenetics ◦ Cancer diagnosis and differential diagnosis ◦ Determine prognosis & clinical trials School of Health Professions

Molecular Genetic Technology

Key Role Clinical laboratory specialty that studies the role of genetics (DNA/RNA/Protein) to discover the relationship between genetics and personal health or identity School of Health Professions

What Is Genome Sequencing? • Different people have slightly different genomes: all humans share 99.9% of the same genetic code. • The 0.1% difference accounts for height, eye color, high cholesterol susceptibility, etc. CTGATGATGGACTACGCTACTACTGCTAGCTGTATTACGA TCAGCTACCACATCGTAGCTACGATGCATTAGCAAGCTAT CGATCGATCGATCGATTATCTACGATCGATCGATCGATCA CTATACGAGCTACTACGTACGTACGATCGCGGGACTATTA TCGACTACAGATAAAACATGCTAGTACAACAGTATACATA GCTGCGGGATACGATTAGCTAATAGCTGACGATATCCGAT CTGATGATGGACTACGCTACTACTGCTAGCTGTATTACGA TCAGCTACAACATCGTAGCTACGATGCATTAGCAAGCTAT CGATCGATCGATCGATTATCTACGATCGATCGATCGATCA CTATACGAGCTACTACGTACGTACGATCGCGTGACTATTA TCGACTACAGATGAAACATGCTAGTACAACAGTATACATA GCTGCGGGATACGATTAGCTAATAGCTGACGATATCCGAT

How? 1. Sample Extraction 3. Genetic Testing PCR DNA Sequencing NGS 2. Sample Quantification 4. Data Analysis School of Health Professions

Molecular Genetics Technology: Projections in the field of Healthcare 2010 2020 2030 Predictive genetic tests Gene-based designer drugs Comprehensive genomics-based available for a dozen for diabetes, hypertension, health care is the norm conditions etc., Interventions to reduce risk Cancer therapy is precisely Illnesses are detected early by available targeted to DNA of tumor molecular surveillance Why hy Molecu Molecular lar Gene enetic ic Tec echnolog hnology? y? Making a dif Making a differ erence ence • Wor orking with cut king with cutting ing edge edge • tec echno hnolog logy Applica pplications ions of of • In Infor orma matics ics Evolving field olving field • School of Health Professions

Radiologic Sciences

Diagnostic Imaging

Key Role  Diagnostic Imaging is a specialty devoted to the study of routine and advanced radiographic imaging procedures  Prominent members of the health care team focused on the diagnosis and treatment of human disease  Specializations in the senior year ◦ CT ◦ MRI ◦ Education ◦ Management ◦ Diagnostic Medical Sonography School of Health Professions

Computed Tomography (CT)  Utilizes ionizing radiation to produce cross-sectional images of the body School of Health Professions

CT & Interventional Radiology Emphasis Used to treat blockages inside arteries and veins, to shut off blood to vessels that nourish tumors, and destroy malignant tumors

Magnetic Resonance Imaging (MRI) Uses strong magnetic field and radio waves to create detailed images of the body

Diagnostic Medical Sonography School of Health Professions

Key Role  A Sonographer is highly-skilled professional who uses ultrasound equipment to create images of structures inside the human body, used for diagnosis School of Health Professions

Areas of Emphasis  Abdomen  Breast  Fetal Echocardiography  Neurosonography  Obstetrics/Gynecology School of Health Professions

Educational Structure • Didactic • Normal anatomy • Pathology • Visual pattern recognition • Teach you how to scan • Technical • Visual pattern recognition • Patient Care • Communication with patients and staff School of Health Professions

Medical Dosimetry School of Health Professions

Key Role  Members of the radiation oncology team.  Create treatment plans for radiation therapy of cancer patients with the goal of destroying the cancerous cells while minimizing the radiation to the surrounding healthy tissues. School of Health Professions

Medical Dosimetrists SPARE Prostate Cancer Courtesy of Dr. Peter Balter School of Health Professions

Medical Dosimetrists  Have the knowledge of anatomy, radiation physics and biology, math, computer, and treatment planning.  Perform radiation dose calculations.  Involved with quality assurance activities to ensure proper treatment of patients. School of Health Professions

Medical Dosimetrists  Have the knowledge of anatomy, radiation physics, math, computer, and treatment planning.  Perform radiation dose calculations using sophisticated treatment planning computers.  Students learn the required skills in the two year program that include classroom, laboratory, and clinical education. School of Health Professions

Radiation Therapy School of Health Professions