Leighton Pritchard & Peter Thorpe Sarah Green Tree Health and - - PowerPoint PPT Presentation
Leighton Pritchard & Peter Thorpe Sarah Green Tree Health and - - PowerPoint PPT Presentation
Use of Technology in the Natural Environment SNH Sharing Good Practice day June 7 2017 eDNA and Plant Pathogen Metabarcoding David Cooke Leighton Pritchard & Peter Thorpe Sarah Green Tree Health and Plant Biosecurity initiative
Terminology
eDNA
- Total DNA extracted from organisms in an
environmental sample
- skin, water, soil, air, gut contents, pollen sac, etc....
- Contemporary samples, permafrost, sediments
NGS/HTS
- Next Gen sequencing/ High throughput sequencing
- Technology - Illumina, Ion Torrent, Nanopore, SMRT
Metagenomics
- Sequencing all DNA in eDNA sample
By Abizar at English Wikipedia, CC BY-SA 3.0
What is metabarcoding?
- Barcoding is a means of discriminating organisms
based on short DNA sequence differences
Species 1 CCACACTGAGCTAAGGCCTTTAA Species 2 CCACACAGAGGTAAGGCCATTAA
- Metabarcoding - massive increase in
throughput due to advancing sequencing technology and reduced prices per base pair
Oxford Nanopore Technologies
eDNA metabarcoding applications
- Specific organisms
- Great crested newt surveys
- Biosecurity – search for quarantine organisms
- Biodiversity inventory - conservation monitoring
- Surveys of fish, fungi, YFO etc
- Research projects
- How does a specific treatment affect biodiversity
Metabarcoding – some pros and cons
- High throughput
- Massively parallel – indexing
- Identifies most species (barcode resolution)
- Identifies organisms that cannot be cultured
- Can share DNA samples – synergy between projects
Some challenges
- Need good sampling and replication
- Will not identify hybrid species
- Error rates and contamination risks – false positive and false
negatives
- Blind acceptance is risky – validation needed
- Data storage and computational biology resources are critical
Method Tool DNA extraction/ PCR DNAseq QC, Trim, Chimera detection Assemble reads Error correction Bayes Hammer Nested PCR Illumina overlapping reads Fastqc, Trimmomatic, Vsearch Flash / PEAR Convert FQ, FA & Trim primers Cluster Seqcrumbs, Biopython
Swarm CD-HIT Vsearch Bowtie Blastclust
Python: sklearn Compare clustering Graphics Summarise species Python Identify species found by all methods, Or what was unique to each method
Leighton Pritchard & Peter Thorpe
Reference database (any)
Coded in Python - will be released on GitHub
Computational biology pipeline
Case Study - Phytophthora
- 167 species – destructive plant pathogens
- 16 species on UK plant health risk register
Dave Rizzo Youtube.com
California Oak Mortality Task Force
Phytophthora zoospore detection
Sampling water
- Irrigation water
- Water flooded through roots
- f pot-grown plants
- Rivers
Filtration
- Cellulose acetate filters
- DNA extraction
- PCR - Phytophthora genus
specific primers
- Sequencing (high or low
throughput)
- Invergowrie Burn (IGB) sampled 56 times
(every 2 weeks) over 2 years at a single sample point
- Filter DNA extracted and PCR with
Phytophthora specific primers
- Run on Illumina MiSeq with v2 chemistry
(896K 250bp reads)
- 30 known and 31 unknown Phytophthora
species detected
Past success…
Some species abundant all year
Quantitative when considering frequency of occurrence between samples
Winter months
- P. xcambivora lower frequency all year
Winter months
Unknown clade 4 species – summer only
Winter months
Herbaceous downy mildew (nettle) summer only
Mycorrhizal Fungi in Montane Heaths
Dr Andy Taylor – James Hutton Institute, Aberdeen
Arctostaphylos alpinus Salix herbecea Arctostaphylos uva-ursi Betula nana
Ectomycorrhizal Host species
36 new records for Scotland (28 UK) 23 taxa are undescribed - new to science 257 ECM taxa recorded 80 taxa appear restricted to the habitat
Alpine Ectomycorrhizal Fungi
Highly diverse, but poorly recorded communities, restricted to a rapidly declining habitat in Scotland.
Emily Carroll
Current Projects at Hutton
- Tree Health and Plant Biosecurity III
- UK Nursery testing
- Environmental diversity
- Baseline testing natural ecosystems
- Aids interception decisions
- Watershed sampling (WP1.3)
- Targeted sampling of catchment
WP1.3.3 Monitoring ECN sites Environmental monitoring THAPBI II nursery sampling
- 3 sites at 5-6 locations
covering a range of habitats
- Additional key sites with
help of Jenny Park (SNH)
Example 1
Hänfling et al., 2016 Environmental DNA metabarcoding of lake fish communities reflects long- term data from established survey methods. Molecular Ecology 25 3101-3119
- eDNA (14 species) better
than conventional gill- netting (4 species)
- Interpretation challenges