Use of Technology in the Natural Environment SNH Sharing Good Practice day – June 7 2017 eDNA and Plant Pathogen Metabarcoding David Cooke Leighton Pritchard & Peter Thorpe Sarah Green Tree Health and Plant Biosecurity initiative
Terminology eDNA • Total DNA extracted from organisms in an environmental sample • skin, water, soil, air, gut contents, pollen sac, etc.... • Contemporary samples, permafrost, sediments NGS/HTS • Next Gen sequencing/ High throughput sequencing • Technology - Illumina, Ion Torrent, Nanopore, SMRT Metagenomics • Sequencing all DNA in eDNA sample By Abizar at English Wikipedia, CC BY-SA 3.0
What is metabarcoding? • Barcoding is a means of discriminating organisms based on short DNA sequence differences Species 1 CCACACTGAGCTAAGGCCTTTAA Species 2 CCACACAGAGGTAAGGCCATTAA • Meta barcoding - massive increase in throughput due to advancing sequencing technology and reduced prices per base pair Oxford Nanopore Technologies
eDNA metabarcoding applications • Specific organisms • Great crested newt surveys • Biosecurity – search for quarantine organisms • Biodiversity inventory - conservation monitoring • Surveys of fish, fungi, YFO etc • Research projects • How does a specific treatment affect biodiversity
Metabarcoding – some pros and cons • High throughput • Massively parallel – indexing • Identifies most species (barcode resolution) • Identifies organisms that cannot be cultured • Can share DNA samples – synergy between projects Some challenges • Need good sampling and replication • Will not identify hybrid species • Error rates and contamination risks – false positive and false negatives • Blind acceptance is risky – validation needed • Data storage and computational biology resources are critical
Computational biology pipeline Coded in Python - will Method Tool be released on GitHub DNA extraction/ PCR Nested PCR DNAseq Illumina overlapping reads QC, Trim, Chimera detection Fastqc, Trimmomatic, Vsearch Error correction Bayes Hammer Assemble reads Flash / PEAR Reference database (any) Convert FQ, FA & Trim primers Seqcrumbs, Biopython Swarm Cluster Identify species found by all CD-HIT methods, Vsearch Or what was unique to each method Bowtie Blastclust Compare clustering Graphics Python: sklearn Summarise species Python Leighton Pritchard & Peter Thorpe
Case Study - Phytophthora • 167 species – destructive plant pathogens • 16 species on UK plant health risk register
Dave Rizzo Youtube.com California Oak Mortality Task Force
Phytophthora zoospore detection Sampling water Filtration • Irrigation water • Cellulose acetate filters • Water flooded through roots • DNA extraction of pot-grown plants • PCR - Phytophthora genus specific primers • Rivers • Sequencing (high or low throughput)
Past success… • Invergowrie Burn (IGB) sampled 56 times (every 2 weeks) over 2 years at a single sample point • Filter DNA extracted and PCR with Phytophthora specific primers • Run on Illumina MiSeq with v2 chemistry (896K 250bp reads) • 30 known and 31 unknown Phytophthora species detected
Some species abundant all year Winter months Quantitative when considering frequency of occurrence between samples
P. xcambivora lower frequency all year Winter months
Unknown clade 4 species – summer only Winter months
Herbaceous downy mildew (nettle) summer only
Mycorrhizal Fungi in Montane Heaths Dr Andy Taylor – James Hutton Institute, Aberdeen
Ectomycorrhizal Host species Arctostaphylos uva-ursi Arctostaphylos alpinus Betula nana Salix herbecea
257 ECM taxa recorded 80 taxa appear restricted to the habitat 36 new records for Scotland (28 UK) 23 taxa are undescribed - new to science
Alpine Ectomycorrhizal Fungi Highly diverse, but poorly recorded communities, restricted to a rapidly declining habitat in Scotland. Emily Carroll
Current Projects at Hutton • Tree Health and Plant Biosecurity III • UK Nursery testing • Environmental diversity • Baseline testing natural ecosystems • Aids interception decisions • Watershed sampling (WP1.3) • Targeted sampling of catchment
Environmental monitoring • 3 sites at 5-6 locations covering a range of habitats • Additional key sites with help of Jenny Park (SNH) THAPBI II nursery sampling WP1.3.3 Monitoring ECN sites
Example 1 • eDNA (14 species) better than conventional gill- netting (4 species) • Interpretation challenges Hänfling et al., 2016 Environmental DNA metabarcoding of lake fish communities reflects long - term data from established survey methods. Molecular Ecology 25 3101-3119
Recommend
More recommend
