introduction to biostrings
play

Introduction to Biostrings Paula Andrea Martinez, PhD. Data - PowerPoint PPT Presentation

Jan 22, 2024 •426 likes •720 views

DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Introduction to Biostrings Paula Andrea Martinez, PhD. Data Scientist DataCamp Introduction to Bioconductor Biological string containers Memory efficient to store and

  1. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Introduction to Biostrings Paula Andrea Martinez, PhD. Data Scientist

  2. DataCamp Introduction to Bioconductor Biological string containers Memory efficient to store and manipulate sequence of characters Containers that can be inherited For example: The BString class comes from big string showClass("XString") showClass("BString") showClass("BStringSet")

  3. DataCamp Introduction to Bioconductor Biostring alphabets DNA_BASES # DNA 4 bases [1] "A" "C" "G" "T" RNA_BASES # RNA 4 bases [1] "A" "C" "G" "U" AA_STANDARD # 20 Amino acids [1] "A" "R" "N" "D" "C" "Q" "E" "G" "H" "I" [11] "L" "K" "M" "F" "P" "S" "T" "W" "Y" "V" DNA_ALPHABET # contains IUPAC_CODE_MAP RNA_ALPHABET # contains IUPAC_CODE_MAP AA_ALPHABET # contains AMINO_ACID_CODE [1] For more information IUPAC DNA codes http://genome.ucsc.edu/goldenPath/help/iupac.html

  4. DataCamp Introduction to Bioconductor

  5. DataCamp Introduction to Bioconductor Transcription DNA to RNA # DNA single string dna_seq <- DNAString("ATGATCTCGTAA") dna_seq 12-letter "DNAString" instance seq: ATGATCTCGTAA # Transcription DNA to RNA string rna_seq <- RNAString(dna_seq) rna_seq 12-letter "RNAString" instance seq: AUGAUCUCGUAA

  6. DataCamp Introduction to Bioconductor Translation RNA to amino acids RNA_GENETIC_CODE rna_seq 12-letter "RNAString" instance seq: AUGAUCUCGUAA # Translation RNA to AA aa_seq <- translate(rna_seq) aa_seq Three RNA bases form one AA: AUG = M, AUC = I, UCG = S, UAA = * 4-letter "AAString" instance seq: MIS*

  7. DataCamp Introduction to Bioconductor Shortcut translate DNA to amino acids dna_seq 12-letter "DNAString" instance seq: ATGATCTCGTAA # translate() also goes directly from DNA to AA translate(dna_seq) 4-letter "AAString" instance seq: MIS* # Same result as before

  8. DataCamp Introduction to Bioconductor The Zika virus

  9. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Let's practice with the Zika virus!

  10. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Sequence handling Paula Andrea Martinez, PhD. Data Scientist

  11. DataCamp Introduction to Bioconductor Single vs set XString to store a single sequence XStringSet for many sequences BString for any string BStringSet DNAString for DNA DNAStringSet RNAString for RNA RNAStringSet AAString for amino acids AAStringSet

  12. DataCamp Introduction to Bioconductor Create a stringSet and collate it # read the sequence as a set zikaVirus <- readDNAStringSet("data/zika.fa") length(zikaVirus) # the set contains only one sequence [1] 1 width(zikaVirus) # and width 10794 bases [1] 10794 # to collate the sequence use unlist zikaVirus_seq <- unlist(zikaVirus) length(zikaVirus_seq) # A 10794-letter "DNAString" instance [1] 10794 width(zikaVirus_seq) # Error unable to find width for "DNAString"

  13. DataCamp Introduction to Bioconductor From a single sequence to a set # to create a new set from a single sequence zikaSet <- DNAStringSet(zikaVirus_seq, start = c(1, 101, 201), end = c(100, 200, 300)) zikaSet A DNAStringSet instance of length 3 width seq [1] 100 AGTTGTTGATCTGTGTGAGTCAGACT...AATTTGGATTTGGAAACGAGAGTTT [2] 100 CTGGTCATGAAAAACCCCAAAGAAGA...GTAAACCCCTTGGGAGGTTTGAAGA [3] 100 GGTTGCCAGCCGGACTTCTGCTGGGT...CAGCAATCAAGCCATCACTGGGCCT length(zikaSet) [1] 3 width(zikaSet) [1] 100 100 100

  14. DataCamp Introduction to Bioconductor Complement sequence a_seq <- DNAString("ATGATCTCGTAA") a_seq 12-letter "DNAString" instance seq: ATGATCTCGTAA complement(a_seq) 12-letter "DNAString" instance seq: TACTAGAGCATT

  15. DataCamp Introduction to Bioconductor Rev a sequence zikaShortSet A DNAStringSet instance of length 2 width seq names [1] 18 AGTTGTTGATCTGTGTGA seq1 [2] 18 CTGGTCATGAAAAACCCC seq2 rev(zikaShortSet) A DNAStringSet instance of length 2 width seq names [1] 18 CTGGTCATGAAAAACCCC seq2 [2] 18 AGTTGTTGATCTGTGTGA seq1

  16. DataCamp Introduction to Bioconductor Reverse a sequence zikaShortSet A DNAStringSet instance of length 2 width seq names [1] 18 AGTTGTTGATCTGTGTGA seq1 [2] 18 CTGGTCATGAAAAACCCC seq2 reverse(zikaShortSet) A DNAStringSet instance of length 2 width seq names [1] 18 AGTGTGTCTAGTTGTTGA seq1 [2] 18 CCCCAAAAAGTACTGGTC seq2

  17. DataCamp Introduction to Bioconductor Reverse complement # Original rna_seq sequence 8-letter "RNAString" instance seq: AGUUGUUG reverseComplement(rna_seq) 8-letter "RNAString" instance seq: CAACAACU # Using two functions together reverse(complement(rna_seq)) 8-letter "RNAString" instance seq: CAACAACU

  18. DataCamp Introduction to Bioconductor

  19. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Let's practice sequence handling!

  20. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Why are we interested in patterns? Paula Andrea Martinez, PhD. Data Scientist

  21. DataCamp Introduction to Bioconductor

  22. DataCamp Introduction to Bioconductor What can we find with patterns? Gene start Protein end Regions that enhance or silence gene expression Conserved regions between organisms Genetic variation

  23. DataCamp Introduction to Bioconductor Pattern matching matchPattern(pattern, subject) 1 string to 1 string vmatchPattern(pattern, subject) 1 set of strings to 1 string 1 string to a set of strings

  24. DataCamp Introduction to Bioconductor Palindromes findPalindromes() # find palindromic regions in a single sequence

  25. DataCamp Introduction to Bioconductor Not new biology The Genetic code was first described by Nirenberg in 1963 On the coding of genetic information Nirenberg, Marshall et al. Cold Spring Harb Symp Quant Biol 1963, 28 How translation might differ according to the reading frame, was first described by Streisinger in 1966 Frameshift Mutations and the Genetic Code Streisinger, George et al. Cold Spring Harb Symp Quant Biol 1966, 31: 77-84

  26. DataCamp Introduction to Bioconductor Translation has six possibilities # Original dna sequence [1] 30 ACATGGGCCTACCATGGGAGCTACGAAGCC # 6 possible reading frames, DNAStringSet [1] 30 ACATGGGCCTACCATGGGAGCTACGAAGCC + 1 [2] 30 GGCTTCGTAGCTCCCATGGTAGGCCCATGT - 1 [3] 29 CATGGGCCTACCATGGGAGCTACGAAGCC + 2 [4] 29 GCTTCGTAGCTCCCATGGTAGGCCCATGT - 2 [5] 28 ATGGGCCTACCATGGGAGCTACGAAGCC + 3 [6] 28 CTTCGTAGCTCCCATGGTAGGCCCATGT - 3 # 6 possible translations, AAStringSet [1] 10 TWAYHGSYEA + 1 [2] 10 GFVAPMVGPC - 1 [3] 9 HGPTMGATK + 2 [4] 9 AS*LPW*AH - 2 [5] 9 MGLPWELRS + 3 [6] 9 LRSSHGRPM - 3

  27. DataCamp Introduction to Bioconductor Conserved regions in the Zika virus Adapted figure From Mosquitos to Humans: Genetic Evolution of Zika Virus Wang, Lulan et al. Cell Host & Microbe 2016, Vol 19 5: 561-565 Facts The Zika Virus has a positive strand genome. It lives in humans, monkeys and mosquitoes. The Flaviviruses family and share 11 conserved proteins.

  28. DataCamp Introduction to Bioconductor INTRODUCTION TO BIOCONDUCTOR Let's practice finding patterns!

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION

INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION

TRAINING COURSE ON SOCIAL PROTECTION &amp; FORMALIZATION TRINIDAD AND TOBAGO MARCH 15, 2017 INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION Design of the NIS Assistance from the

547 views • 23 slides
INTRODUCTION Introduction 2/42 INTRODUCTION Alternations I am giving bread to the

INTRODUCTION Introduction 2/42 INTRODUCTION Alternations I am giving bread to the

Patterns of variation in the expression of case and agreement Andrs Brny Leiden University Centre for Linguistics 9 November 2019, BaSIS Workshop a.barany@hum.leidenuniv.nl INTRODUCTION Introduction 2/42 INTRODUCTION

1.37k views • 42 slides
Introduction Introduction Introduction Introduction Outline Motivation Failures

Introduction Introduction Introduction Introduction Outline Motivation Failures

Introduction Introduction Introduction Introduction Outline Motivation Failures Definition and concepts Process and product properties Principles SE Approaches Motivation Software and the economy The economies of

1.03k views • 49 slides
Introduction Introduction Introduction Nationwide Cause for Concern 1

Introduction Introduction Introduction Nationwide Cause for Concern 1

Introduction Introduction Introduction Nationwide Cause for Concern 1 https://www.cdc.gov/std/stats17/infographic.htm Introduction Epidemiology in Western Colorado CPHE Surveillance Data Report, May 2018 Chlamydia Epidemiology in Western

977 views • 39 slides
DAQ introduction Purpose of this talk : (1) Introduction for those who have not been in every

DAQ introduction Purpose of this talk : (1) Introduction for those who have not been in every

DAQ introduction Purpose of this talk : (1) Introduction for those who have not been in every meeting (2) Some ideas of diagrams for section 7.1 (Introduction) of TP. Giles Barr 25 Jan 2018, Pembroke College On DUNE, the reality is there is a

474 views • 10 slides
INTRODUCTION cf. Schneider, Chapter 1 INTRODUCTION THEY ARE OUT TO GET YOU INTRODUCTION WHAT

INTRODUCTION cf. Schneider, Chapter 1 INTRODUCTION THEY ARE OUT TO GET YOU INTRODUCTION WHAT

ADVANCED COMPUTER SECURITY INTRODUCTION cf. Schneider, Chapter 1 INTRODUCTION THEY ARE OUT TO GET YOU INTRODUCTION WHAT IS SECURITY? A systems security policies describe What the system is supposed to do Store and provide access

479 views • 16 slides
Overview Introduction to SMIL Introduction to W3C and XML Introduction to SMIL

Overview Introduction to SMIL Introduction to W3C and XML Introduction to SMIL

Overview Introduction to SMIL Introduction to W3C and XML Introduction to SMIL Writing a SMIL file Adding Media Objects Martin Halvey Clipping media files January 2008 Timing and Synchronising Layout World Wide

387 views • 14 slides
14 Introduction Introduction Bad guys can put malware into Example: hosts

14 Introduction Introduction Bad guys can put malware into Example: hosts

Introduction Introduction source Encapsulation ISO/OSI reference model message M application segment H t H t M transport network datagram H n H n H t M presentation: allow applications to frame link H l H n H t M interpret

583 views • 4 slides
Previous Lecture Introduction to SMIL 2 Introduction to W3C and XML Introduction to SMIL

Previous Lecture Introduction to SMIL 2 Introduction to W3C and XML Introduction to SMIL

Previous Lecture Introduction to SMIL 2 Introduction to W3C and XML Introduction to SMIL Writing a SMIL file Adding Media Objects Martin Halvey Clipping media files January 2008 Timing and Synchronising Layout

322 views • 8 slides
Lecture 1 Andreas Habegger Introduction Zynq Introduction Zynq Introduction Zynq PS vs. PL

Lecture 1 Andreas Habegger Introduction Zynq Introduction Zynq Introduction Zynq PS vs. PL

Introduction Zynq Lecture 1 Andreas Habegger Introduction Zynq Introduction Zynq Introduction Zynq PS vs. PL Processing System Processor Peripherals Data Buses AXI Bus Conclusion BTE5380 - Embedded Systems Octobre 2014 Andreas Habegger

1.81k views • 30 slides
2018.06 01 SMILE5 Introduction S E 5 02 Alpha Cloud M I L 03 Company Introduction 04

2018.06 01 SMILE5 Introduction S E 5 02 Alpha Cloud M I L 03 Company Introduction 04

2018.06 01 SMILE5 Introduction S E 5 02 Alpha Cloud M I L 03 Company Introduction 04 Project References S E 5 PART.1 SMILE5 Introduction M I L Introduction STORION-SMILE5 Residential Energy Storage System Inverter 5kW Output Input

1.06k views • 25 slides
Introduction to CICS Course introduction Course introduction What is CICS? What is an

Introduction to CICS Course introduction Course introduction What is CICS? What is an

Introduction to CICS Course introduction Course introduction What is CICS? What is an application server? Why use an application server? Course introduction Services provided by CICS How CICS applications are defined Scaling CICS to meet

1.84k views • 146 slides
Network Visualization Introduction Presented by Shahed Introduction Introduction Basic

Network Visualization Introduction Presented by Shahed Introduction Introduction Basic

Network Visualization Introduction Presented by Shahed Introduction Introduction Basic building blocks Node Links (relationship between nodes) Spatial information Network data

584 views • 9 slides
Introduction Introduction (1) Main argument of the paper: universities are not only

Introduction Introduction (1) Main argument of the paper: universities are not only

Le jugement des pairs comme outil de management des universits Peer-review as a management tool Christine Musselin (CSO, Sciences Po et CNRS) Avril 2013, Lirrsistible ascension du capitalisme acadmique Introduction Introduction (1)

590 views • 28 slides
Introduction Introduction to storage and to storage and filesystems filesystems Introduction

Introduction Introduction to storage and to storage and filesystems filesystems Introduction

Moreno Baricevic Gilberto Daz Axel Kohlmeyer Stefano Cozzini ULA ICTP CNR-IOM DEMOCRITOS Merida, VENEZUELA Trieste, ITALY Trieste, ITALY Introduction Introduction to storage and to storage and filesystems filesystems Introduction

1.19k views • 51 slides
JABLOTRON JA-100 introduction November 2011 Introduction Todays goals First introduction of

JABLOTRON JA-100 introduction November 2011 Introduction Todays goals First introduction of

JABLOTRON JA-100 introduction November 2011 Introduction Todays goals First introduction of the brand new JA-100 alarm system Visions Basic architecture System components Setting Help us with final validations You are the FIRST ones

1.69k views • 111 slides
Lab Automation by WWT: Ansible Tower and Cisco DNA Center as a Platform Andrius Benokraitis Jeff

Lab Automation by WWT: Ansible Tower and Cisco DNA Center as a Platform Andrius Benokraitis Jeff

Lab Automation by WWT: Ansible Tower and Cisco DNA Center as a Platform Andrius Benokraitis Jeff Andiorio Product Manager Technical Solutions Architect andriusb@redhat.com Jeff.andiorio@wwt.com WHAT WERE TALKING ABOUT TODAY Upcoming

1.05k views • 37 slides
Ultra high throughput DNA sequencing technologies Keith Harshman DNA Array Facility Center for

Ultra high throughput DNA sequencing technologies Keith Harshman DNA Array Facility Center for

Ultra high throughput DNA sequencing technologies Keith Harshman DNA Array Facility Center for Integrative Genomics University of Lausanne Outline: 1. What UHTS is replacing: Sanger sequencing/CE 2. Current UHTS next generation

928 views • 75 slides
Recombinant DNA Regulations Simon Muchohi, PhD, MPH, CIH, CSP, CHMM, Director of Biological Safety,

Recombinant DNA Regulations Simon Muchohi, PhD, MPH, CIH, CSP, CHMM, Director of Biological Safety,

Biological Laboratory and Recombinant DNA Regulations Simon Muchohi, PhD, MPH, CIH, CSP, CHMM, Director of Biological Safety, BPHC PJ McCann , Esq., Deputy General Counsel, BPHC January 16, 2019 1 Boston Regulatory Framework Recombinant DNA

228 views • 12 slides
Molecular Programming Luca Cardelli University of Oxford 2018-10-10 , ECSS Gothenburg

Molecular Programming Luca Cardelli University of Oxford 2018-10-10 , ECSS Gothenburg

Molecular Programming Luca Cardelli University of Oxford 2018-10-10 , ECSS Gothenburg Objectives The promises of Molecular Programming: In Science &amp; Medicine In Engineering In Computing The current practice of Molecular

1.01k views • 73 slides
10.1 Experiments showed that DNA is the genetic material 10.2 DNA and RNA are polymers of

10.1 Experiments showed that DNA is the genetic material 10.2 DNA and RNA are polymers of

10.1 Experiments showed that DNA is the genetic material 10.2 DNA and RNA are polymers of nucleotides 10.3 DNA is a double-stranded helix 10.4 DNA replication depends on specific base pairing 10.5 DNA replication proceeds in two directions

686 views • 23 slides
Targeting the Genotype Request 9 th Annual International SADS Foundation Conference Susan P.

Targeting the Genotype Request 9 th Annual International SADS Foundation Conference Susan P.

Targeting the Genotype Request 9 th Annual International SADS Foundation Conference Susan P. Etheridge, MD University of Utah COI/Declarations I had to learn genetics on YouTube to present this talk A very long time later, in 1929 1929 ~

843 views • 39 slides
influenza 18.2 Viral Structure and Reproduction TEKS 4C KEY CONCEPT Viruses exist in a variety

influenza 18.2 Viral Structure and Reproduction TEKS 4C KEY CONCEPT Viruses exist in a variety

18.2 Viral Structure and Reproduction TEKS 4C The student is expected to: 4C Compare the structures of viruses to cells, describe viral reproduction, and describe the role of viruses in causing diseases such as human immunodeficiency virus

457 views • 17 slides
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface

Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface

Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art or science of making practical. Chris

376 views • 19 slides

More recommend