Information and Information Processing in Biological Systems Peter - - PowerPoint PPT Presentation

Information and Information Processing in Biological Systems

Peter Schuster, Eörs Szathmáry, and Avshalom Elitzur

Institut für Theoretische Chemie, Universität Wien, Austria, Collegium Budapest – Institute for Advanced Study , Ungarn, and Bar-Ilan University, Israel

Europäisches Forum Alpbach Alpbach, 18.– 25.08.2005

Web-Pages for further information: http://www.tbi.univie.ac.at/~pks http://www.colbud.hu/fellows/szathmary.shtml http://faculty.biu.ac.il/~elitzua/

Program

Friday, Aug.19: 9:00-9:30 Peter Schuster, Evolution and Information 9:30-10:15 Avshalom Elitzur, Information, Complexity and the Physics of Life 10:15-10:30 Coffee Break 10:30-11:30 Avshalom Elitzur, Information, Complexity and the Physics of Life 11:30-12:00 Discussion Saturday, Aug.20: 9:00-10:00 Eörs Szathmáry, Genetics and Genes. Mendel 1865 and Today 10:00-10:30 Coffee Break 10:30-11:30 Peter Schuster, Multiplication, Mutation and Selection 11:30-12:00 Discussion Monday, Aug.22: 9:00-10:00 Eörs Szathmáry, Error Propagation in Cellular Information Processing 10:00-10:30 Coffee Break 10:30-12:00 Avshalom Elitzur, Peter Schuster, and Eörs Szathmáry, Physics, Biology, Evolution and Information – Panel Discussion

Program

Tuesday, Aug.23: 9:00-10:00 Peter Schuster, Evolution Experiments in the Laboratory 10:00-10:30 Coffee Break 10:30-12:00 Contribution by Participants and Discussion Wednesday, Aug.24: 9:00-10:00 Eörs Szathmáry, Development – From Cells to Organisms 10:00-10:30 Coffee Break 10:30-12:00 Contribution by Participants and Discussion 19:00- Informal Discussion at Hotel Alpbach Thursday, Aug.25: 9:00-9:30 Peter Schuster, Primitive Forms of Learning 9:30-9:45 Hans Flohr, Semantic Information 9:45-10:30 Eörs Szathmáry, Language 10:30-11:00 Coffee Break 11:00-12:00 Avshalom Elitzur, Peter Schuster, and Eörs Szathmáry, Summary of the Seminar and Panel Discussion

Evolution and Information

Peter Schuster, Institut für Theoretische Chemie, Universität Wien

Genotype, Genome Phenotype

Unfolding of the genotype

Highly specific environmental conditions Developmental program

Collection of genes

Evolution

Genotype, Genome

GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA

Phenotype

Unfolding of the genotype

Highly specific environmental conditions Biochemistry molecular biology structural biology molecular evolution molecular genetics systems biology bioinfomatics

Max Perutz Hemoglobin sequence Gerhard Braunitzer Molecular evolution Linus Pauling and Emile Zuckerkandl The exciting RNA story evolution of RNA molecules, ribozymes and splicing, the idea of an RNA world, selection of RNA molecules, RNA editing, the ribosome is a ribozyme, small RNAs and RNA switches.

Omi Omics

‘the new biology is the chemistry of living matter’ James D. Watson und Francis H.C. Crick

Earlier abstract of the ‚Origin of Species‘

Alfred Russell Wallace, 1823-1913 Charles Robert Darwin, 1809-1882

The two competitors in the formulation of evolution by natural selection

Key ingredients in Darwin‘s theory of evolution are: (i) Variations occurring spontaneously and not themselves produced by the environment, (ii) Competition for resources, so that only the best adapted survive to reproduce, and, therefore (iii) Selection by the environment, of which variants will survive and increase in number.

dx / dt = x - x x

i i i j j

; Σ = 1 ; i,j f f

i j

Φ Φ fi Φ = ( = Σ x

• i

)

j j

x =1,2,...,n [I ] = x 0 ;

i i

i =1,2,...,n ; Ii I1 I2 I1 I2 I1 I2 I i I n I i I n I n

+ + + + + +

(A) + (A) + (A) + (A) + (A) + (A) + fn fi f1 f2 I m I m I m

+

(A) + (A) + fm fm fj = max { ; j=1,2,...,n} xm(t) 1 for t

• [A] = a = constant

Reproduction of individuals as basis of selection

s = ( f2-f1) / f1; f2 > f1 ; x1(0) = 1 - 1/N ; x2(0) = 1/N

200 400 600 800 1000 0.2 0.4 0.6 0.8 1 Time [Generations] Fraction of advantageous variant s = 0.1 s = 0.01 s = 0.02

Selection of advantageous mutants in populations of N = 10 000 individuals

time

Charles Darwin, The Origin of Species, 6th edition. Everyman‘s Library, Vol.811, Dent London, pp.121-122.

4 4 2 + + 3 + 2 2 + Dominant/recessive pair of alleles Intermediate pair of alleles 2 2 + F2 = F1 F1

• F1

P F1 = P P

• P

F1 ×

Gregor Mendels laws of inheritance:

Versuche über Pflanzen-Hybriden. Verhandlungen des naturforschenden Vereins in Brünn, 4: 3-47 (1865) Presented at the Meetings of 08.02. and 08.03.1965

John Burdon Sanderson Haldane, 1892-1964 Sir Ronald Aylmer Fisher, 1890-1962 Sewall Wright, 1889-1988

The three scholars of theoretical population biology

Theodosius Dobzhansky, 1900 – 1975 „Nothing in biology makes sense except in the light of evolution.“

Evolution is the comprehensive basis of macroscopic and molecular biology

Ernst Mayr, 1904 – 2005 Author of the book: ‚The Origin of Biological Thought‘ The best known proponent of the ‚Neo-Darwinian‘ or synthetic theory of evolution which reconciled Darwinian evolutionary biology and Mendelian genetics.

The three-dimensional structure of a short double helical stack of B-DNA

James D. Watson, 1928- , and Francis Crick, 1916-2004, Nobel Prize 1962

Canonical Watson-Crick base pairs: cytosine – guanine uracil – adenine

W.Saenger, Principles of Nucleic Acid Structure, Springer, Berlin 1984

Complementary replication is the simplest copying mechanism

• f RNA.

Complementarity is determined by Watson-Crick base pairs: GC and A=U

G G G C C C G C C G C C C G C C C G C G G G G C

Plus Strand Plus Strand Minus Strand Plus Strand 3' 3' 3' 3' 5' 3' 5' 5' 5'

Point Mutation Insertion Deletion

GAA AA UCCCG GAAUCC A CGA GAA AA UCCCGUCCCG GAAUCCA

Mutations in nucleic acids represent one mechanism of variation of genotypes.

‚Replication fork‘ in DNA replication The mechanism of DNA replication is ‚semi-conservative‘

Genetic recombination as the second mechanism of variation is the molecular basis

• f Mendelian genetics.

Max Perutz, 1914-2002, at the opening

• f the Max Perutz-Library, Vienna

BioCenter, in 1994 Nobel Prize 1962

Information processing in the cell

A B C D E F G H I J K L 1

Biochemical Pathways

2 3 4 5 6 7 8 9 10

The reaction network of cellular metabolism published by Boehringer-Ingelheim.

The citric acid

• r Krebs cycle

(enlarged from previous slide).

Claude Elwood Shannon, 1916 – 2001 Formulated a theory of communication and transmittal of messages through channels including error propagation. The constent of information is the negative logarithm (to the basis 2) of the probability to receive a message chosen from a given set: I = - 1.4427 log pk [bit]

Computer adapted alphabet: {0,1}; message: 001010111010100101101.....1

Information content of a DNA sequence: I = - 1.4427 log pk [bit], where the bit refers to the binary alphabet: 0,1

GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA

N = 76 allows for 476 = 5708990770823839524233143877797980545530986496 = = 5.709 1045 different sequences I = - 1.4427 log (1/476) = 152 [bit] implying 2 bits per digit, since the alphabet is A,U,G,C

Questions to be analyzed and dicussed in the seminar How is biological information related to the physics of living matter and to the science of complexity? How is biological information processed in present day organisms? How did biological information originate in evolution? Can the Darwinian mechanism explain the increase in biological complexity during evolution? How did learning and language originate in societies?