Influence of Temperature on MBBR Denitrification for Advanced - - PowerPoint PPT Presentation
Influence of Temperature on MBBR Denitrification for Advanced Nitrogen Removal of Wastewater Treatment Plant Effluent Haiyan Wang K. Liu,Q.Y. Hang, Q. Yuan, M.J. Ma, and C. M. Li Research Center for Water Pollution Control Technology Chinese
Haiyan Wang
Research Center for Water Pollution Control Technology
Chinese Research Academy of Enviromental Sciences
2016.09.16 Tel:86-10-84915322, Email: wanghy@craes.org.cn
1
2
plant (WWTP) effluent was large(3.4 × 1010 ton/year)
water.
plant (WWTP) effluent was large(3.4 × 1010 ton/year)
water. 3
Discharge Standard of Pollutants for Municipal Wastewater Treatment Plant (GB18918-2002) Environmental Quality Standards for Surface Water (GB3838-2002)
recharge water for water sources, natural wetlands or rivers
Actived Sludge Bioflim
MBBR
Influent Aeration/ Mixing Effluent
Denitrification MBBR reported for sewage wastewater (Aspegren et al., 1998; Mases et al. 2010), nitrate contaminated seawater(Labelle, et al., 2005) and landfill leachate (Cortez et al., 2011) nitrogen removal with good denitrification effficiency.
The full‐scale MBBRs had also been applied since 1997 & 1999 for post denitrification in Sjölunda and Klagshamn WWTPs of Malmö City, Sweden, and the effluent TN could met the WWTP limitation (Mases et al. 2010).
Influencing factors
temperature the ratio of carbon to total nitrogen(C/N) mixing speed Carriers types hydraulic retention time (HRT)
advanced nitrogen removal, and the influencing of carriers types, hydraulic retention time (HRT) and C/N ratio on its efficiency have been studied extensively in our published studies (Yuan et al. 2015; 2016). Temperature
influence
Microorganisms WWTPs built outside Variation obviously in different seasons in North China denitrification efficiency HOW the denitrificans community change?
nosZ N2O N2 Nar narG napA Nir nirS nirK Nor norB norZ Nap Cu‐Nir qNor Nos NO NO3
MBBR : 6.0 L volume and 5.7 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP C/N ratio: methanol addition to adjust C/N ratio to 8 HRT 12h Polyethylene carriers with 25 mm diameter, 10 mm height, 0.96~0.98 g/L density and 620 m2/m3 specific surface area.
Time(d) Temperature() CODCr(mg/L) TN(mg/L) NO3
‐‐N (mg/L)
Phase I(1‐49d) 13 104.6±86.3 11.1±7.0 4.8±2.6 PhaseII(50‐98d) 19 109.7±82.0 12.0±7.6 4.2±2.6 PhaseIII(99‐147d) 25 87.8±29.7 10.7±2.7 3.9±2.1 PhaseIV(148‐190d) 30 85.6±30.4 10.6±2.7 4.0±2.1
Table1 Influent ingredients and operation conditions
PE
Time(d) Temperature( ) CODCr(mg/L) TN(mg/L) NO3
‐‐N (mg/L)
1‐3 30 117.8 11.1 4.6 4‐6 25 109.0 11.9 4.1 7‐9 20 91.4 11.8 4.5 10‐12 15 113.4 11.2 4.3 13‐15 10 95.8 11.6 4.4
MBBR : 2.5 L volume and 2.0 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP Carriers filling rate: 30% C/N ratio: methanol addition to adjust C/N ratio to 8 HRT: 12h Sampling once every hour for 8 times in one HRT
TN :TN unit of TOC‐VCPH analyzer NO3
‐‐N and NO2 ‐‐: Ion chromatography (Dionex ICS‐1000
NH4
+‐N :Nessler's reagent spectrophotometry method
COD :COD speedy testing pH :S‐25 pH Analyzer Water Quality Index Detection DOM analysis Three‐dimensional excitation‐emission matrix (EEM) fluorescence spectrophotometer Excitation source was used for the spectrometer, both excitation (Ex) and emission (Em) were 200‐450 nm with 5 nm bandwidth, and the scanning speed was 12000 nm•min‐1.
DNA extraction and qPCR analysis DNA extraction: UltraClean DNA extraction kit Two‐step Q‐PCR amplification procedure: 95 for 10 min; 40 cycles of 95 for 15 s, 60 for 1 min.
Primers References NarG‐F 5’‐TA(CT)GT(GC)GGGCAGGA(AG)AAA ‐3’ Smith et al., 2015 NarG‐R 5’‐ CGTAGAAGAAGCTGGTGCTGTT‐3’ NirS‐F 5’‐ GTSAACGTSAAGGARACSGG‐3’ Kandeler et al., 2006 NirS‐R 5’‐ GASTTCGGRTGSGTCTTGA‐3’ NosZ‐F 5’‐ CG(C/T)TGTTC(A/C)TCGACAGCCAG ‐3’ Mao et al., 2011 NosZ‐R 5’‐ G(G/C)ACCTT(G/C)TTGCC(C/G)T(T/C)GCG ‐3
Biomass analysis and SEM observation Biomass: SS weight method (Liu, 1992) SEM:HITACHI S‐570 SEM
Influence of temperature on NO3
‐‐N Removal 50 100 150 200 4 8 12 16 20 20 40 60 80 100
（ ） Time d Influent Effluent Removal rate 30( ) 25( ) 19( ) 13( ) NO
NO
The NO3
and it indicated the temperature has little effect on the nitrate removal at 12h HRT, which might be because the long HRT (12h) of the MBBR could compensate for the low denitrification rate at low temperature.
Temper ature() NO3
‐‐N (mg/L)
NO3
—N removal
(%) NO3
‐‐N removal
rate (mg NO3
‐‐
N∙(L∙d)‐1)
13 4.8±2.6 82.9±26.7 %, 4.8±2.6 19 4.2±2.6 80.1±27.2 % 4.2±2.6 25 3.9±2.1 85.0±22.3 % 3.9±2.1 30 4.0±2.1 82.9±13.3% 4.0±2.1
Influence of temperature on NO3
‐‐N Removal
in sequencing batch tests
1 2 3 4 5 6 7 8 9 1 2 3 4 5 NO
Time(h) 10( ) 15( ) 20( ) 25( ) 30( )
Tempe rature( ) Time for complete NO3
—N
removal (h) The denitrification Rate(mg/L∙h) 10 7 0.64 15 7 0.58 20 6 1.12 25 5 1.29 30 5 1.14 With the long HRT(12h), the microorganisms at low temperature could arrive the same removal efficiency as that of the high temperature for the time compensation (Zinatizadeh & Ghaytooli, 2015). The batch tests also explained why the similar nitrate removal were obtained at long HRT (12h ) at 13, 19, 25 and 30.
Influence of temperature on the Removal of Nitrogen in Other Form
Temper atu ‐re () NH4
+‐N
NO2
‐‐N
TN Influent (mg/L) Effluent (mg/L) Removal Influent (mg/L) Effluent (mg/L) Removal Influent (mg/L) Effluent (mg/L) Removal 13 0.8±0.7 0.5±0.4 27.2±46. 3 2.0±1.2 1.8±0.8 4.3±3.6 11.1±6.9 5.5±4. 1 53.1±2 8.4 19 0.9±0.8 0.7±0.4 23.5±51. 1 2.0±1.2 1.9±0.7 4.1±3.3 12.0±6.9 6.2±4. 2 49.0±2 8.2 25 0.8±0.3 0.6±0.4 30.5±24. 9 2.3±0.7 2.3±0.6 4.2±7.1 10.7±2.7 4.9±2. 2 52.8±1 6.8 30 0.7±0.4 0.5±0.3 31.3±11. 1 2.5±0.6 2.4±0.7 6.1±7.3 10.5±2.8 4.8±3. 54.6±2 3.9
The low NH4
+-N and NO2
, and they were not influenced obviously by the temperature in the batch tests. TN were also not affected by temperature obviously.
COD removal
63.8±19.5%, which indicated that the temperature had little effect on the COD removal
CODCr removal rate increased gradually with the temperatures of 10, 15, 20, 25 and 30.
DOM removal
Effluent
The total fluorescence intensity removal were 47.6%, 49.0%, 50.5% and 52.5% respectively
Peak I and II: tryptophan-like substances Peak III: the visible fulvic acid-like substance Peak IV: the UV fulvic acid-like substance Effluent Effluent Effluent Inffluent
Biomass analysis and SEM observation
Temperature( ) 13 19 25 30 Bioma ss (mg/g) 6.9 9.4 11 14.1
13 19 25 30
Bacilliform, filiform and spheroidal form Temperature had little influence on the carriers surface morphology, which consisted with the biomass analysis.
Temperature() 13 19 25 30 narG gene (copies/g‐SS) 2.04× 109 1.59 ×109 1.65×109 7.19× 108 nirS gene (copies/g‐SS) 1.76× 109 1.95 × 109 1.20× 109 8.43× 108 nosZ gene (copies/g‐SS) 1.63 × 107 4.45× 106 2.56× 106 2.38× 106
The content of narG, nirS and nosZ genes at 13 and 19 conditions were higher than those under 25 and 30. The highest abundance of narG, nirS and nosZ genes, i.e. 2.04×109 , 1.95×109 and 1.63×107copies/g-SS, were achieved at 13, 19 and 13 respectively, which were consistent with the long 12h HRT compensation.
temperature of 13, 19, 25 and 30 at 12h HRT for polyethylene MBBR, the NO3
82.9±13.3%. The long HRT of 12h may compensate for the denitrification ability of low temperature, which resulted the similar nitrate removal and denitrification rate at different temperatures.
Quality Standards for Surface Water (GB 3838-2002). Three-dimensional fluorescence spectra showed that both of the MBBR influent and effluent contained DOM, such as fulvic acid-like and tryptophan-like substance, etc., and the total fluorescence intensity removal were 47.6%, 49.0%, 50.5% and 52.5%, respectively, at different temperatures.
conditions were higher than those under 25 and 30. The highest abundance of narG and nosZ genes, i.e. 2.04×109 and 1.63×107copies/g-SS were achieved at 13, which were consistent with the long 12h HRT compensation. The abundance of narG nitrate- reducing gene and nirS nitrite-reducing gene were both greater than that of nosZ nitrous oxide reducing gene.
denitrification genes abundance as a whole, 25 was the optimum temperature for nitrogen removal of WWTP effluent by denitrification MBBR.
Pollution Control and Treatment (2014ZX07216-001)