hbv
play

HBV Testing for drug resistance and resistance interpretation - PowerPoint PPT Presentation

HBV Testing for drug resistance and resistance interpretation Martin Dumer Institute of Immunology and Genetics Kaiserslautern Genome of HBV HBV drug resistance testing technical approach 0.25 Product 1 (base 377 to 864) For: 5


  1. HBV Testing for drug resistance and resistance interpretation Martin Däumer Institute of Immunology and Genetics Kaiserslautern

  2. Genome of HBV

  3. HBV drug resistance testing – technical approach •0.25 Product 1 (base 377 to 864) For: 5’ GGATGTGTCTGCGGCGTTT3’ Rev: 5’ ACCCCATCTTTTTGTTTTGTTAGG3’ Product 2 (base 252 to 819) For: 5’ AGACTCGTGGTGGACTTCTCT3’ Rev: 5’ CAAAAGAAAATTGGTAACAGCGGTA3’ Allen et al., 1998 •N236T •0.87

  4. Editing: Seqman (Lasergene)

  5. HBV Resistance Mutations Terminal Spacer Pol/ RT RNaseH protein 845 a.a. GVGLSPFLLA YMDD I(G) II(F) A B C D E rtL80V/ I LAM resistance rtV173L rtM204V/ I / S rtL180M rtN236T ADV resistance rtA181T/ V rtl233V ? ETV resistance rtL180M rtM204V/ I rtT184S/ A/ I / L rtS202G/ C rtM250I / V LdT resistance rtL80V/ I rtL180M rtM204I TDF resistance rtA194T rtM204V rtL180M Allen MI, et al. Hepatology. 1998;27:1670-1677. Qi X, et al. J Hepatol. 2004;40(suppl 1):20- 21. Tenney D, et al. Antimicrob Agents Chemother. 2004;48:3498-3507. Tyzeka [package insert]. Lai CL, et al. Gastroenterology. 2005;129:528-536. Schildgen O, et al. N Engl J Med. 2006;354:1807-1812. Locarnini S. 2006 IDRW. Abstract P2.

  6. •Schaefer, J Viral Hep 2005 worldwide distribution HBV genotypes-

  7. HBV genotypes - Cologne data D ■ genotype D is predominating E G B A

  8. Genafor/ Arevir HBV drug resistance interpretation tool [genafor.org]

  9. Genafor/ Arevir HBV drug resistance interpretation tool

  10. Genafor/ Arevir HBV drug resistance interpretation tool

  11. www.genafor.org Joachim Selbig, MPI für Molekulare Pflanzenphysiologie Golm und Universität Potsdam Joachim Büch, Andre Altmann, Thomas Lengauer, MPI für Informatik Saarbrücken Rolf Kaiser, Nadine Sichtig, Saleta Sierra Aragon, Melanie Balduin, Eugen Schülter , Herbert Pfister , Institut für Virologie, Gerd Fätkenheuer, Innere Medizin I, Universitätsklinik zu Köln Ulrike Schuldenzucker Europa Fachhochschule Fresenius, Köln Klaus Korn, Barbara Schmidt, Hauke Walter, Nationales Referenzzentrum für Retroviren, Universität Erlangen-Nürnberg • Patrick Braun, Robert Ehret, Heribert Knechten Praxiszentrum Blondelstraße, Aachen • Bernd Kupfer, Bertfried Matz, Karl E. Schneweis, Med. Mikrobiologie Jürgen K. Rockstroh, Medizinische Klinik I, Universitätsklinik Bonn Mark Oette, Claudia Müller, Klinik f. Gastroenterologie, Hepatologie u. Infektiologie, Universitätsklinikum Düsseldorf

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend


More recommend