Designing new agonists and antagonists of Designing new agonists and - PowerPoint PPT Presentation

Designing new agonists and antagonists of Designing new agonists and antagonists of glycoprotein hormones using site- -directed directed glycoprotein hormones using site mutagenesis and gene transfer mutagenesis and gene transfer Dr. Fuad Fares November 8, 2004

Recombinant Proteins Recombinant Proteins  Gene Cloning  Transfection into Eukaryotic or Prokaryotic cells  Purification

Gene Modifications Gene Modifications  Site - Directed Mutagenesis  Gene Fusion Development of new agonists & antagonists

Structure – Function Glycoprotein Hormones • Site – Directed Mutagenesis & gene fusion Development of Agonists & Antagonists

Glycoprotein Hormone Family CTP hCG FSH LH TSH Placenta Pituitary

Glycoprotein hormones mechanism of action

Glycoprotein Hormone Subunits N N  N N hFSH  N hLH  N hTSH  N N hCG  3

O O O SerSerSerSerLysAlaProProProSerLeuProSerProSerArgLeu O Pro GlyProSerAspThrProIleLeuProGln

Glycoprotein Hormone Subunits N N  N N hCG  Stop Codon N N TAA Mutated TAG N hCG  N TGA 3

Deletion of CTP from hCG - No effect on the assembly of subunits - No effect on receptor binding - No effect on in vitro bioactivity - Significantly decreased the bioactivity in vivo

Designing New Analogs Designing New Analogs  Follicle-Stimulating Hormone - Used for stimulation of follicular development in women - Injected daily

Designing New FSH Analog hFSH Gene hCG Gene CTP hFSH Gene CTP

Secretions d d

Biological Activity Biological Activity in vitro in vitro Receptor binding Biological Activity

Estrogen (pg/ml) Control FSH-WT F S H - C T P

O O O SerSerSerSerLysAlaProProProSerLeuProSerProSerArgLeu O Pro GlyProSerAspThrProIleLeuProGln

Biological Activity Biological Activity 50 40 E2 Production 30 (ng/ml) 20 10 0 FSH-WT FSH-CTP FSH-CTP CHO Idl-D

Half Life, in vivo Half Life, in vivo

Designing Long Acting Designing Long Acting Erythropoietin (EPO) Erythropoietin (EPO)  EPO is Produced in the kidney  Glycoprotein hormone involved with growth and development of mature red blood cells from erythrocyte precursor cells.

Therapeutic use of EPO Therapeutic use of EPO o EPO has a wide clinical use; - Several forms of anemia , including those associated with renal failure, HIV infection, blood loss, and chronic disease. - EPO injected three times/week

EPO Market EPO Market  Treatment for chronic dialysis patients estimated between $8,000 and $10,000 per patient per year  Market volume of its usage worldwide estimated at around $6 billion per year

Designing New EPO Analog hCG  hEPO Gene Gene CTP hEPO Gene CTP

Human EPO Human EPO Amino Acid Sequence Amino Acid Sequence

EPO- -CTP Construction CTP Construction EPO 2 1 3 4 EPO cDNA CTP AgeI BamHI N N N O O O O O | | | | | | | | NH2...Asn-X-Thr … Asn-X-Thr...Asn-X-Ser … ...Ser … ..Ser...Ser...Ser...Ser.....COOH 24 38 83 126

Human EPO- -CTP CTP Human EPO cDNA Sequence Sequence cDNA ACCAGATCTACCGGTCATCATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCT CCTGTCCCTTCTGTCGCTCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCT CATCTGTGACAGCCGAGTCCTGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAA TATCACGACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGA CATCAAAGTTAATTTCTATGCCTGGAAGAGGATGGAGGTCGGGCAGCAGGCCGTAGA AGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTT GGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAG TGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGAAGGAAGCCAT CTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTT CCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACAC AGGGGAGGCCTGCAGGACAGGGGACAGATCCTCTTCCTCAAAGGCCCCTCCCCCGAG CCTTCCAAGTCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATA AAGGTCTTCTGGATCCGCACTCTGGAGGTTAA

Cloning Cloning Plasmid Plasmid Cloning site invivogen

Secretion

Receptor Binding 0.1 2.5 5 10 20 EPO  U/ml

In vitro Bioactivity

In vivo Bioactivity

In vivo Bioactivity

In vivo Bioactivity

EPO – – long acting long acting EPO  Bind with high affinity to hEPO receptor  The half – life is 2-3 times higher than EPO-WT

In vivo half-life

Summary Summary  O - linked oligosaccharides have no role in receptor binding and in vitro bioactivity of the hormone  Ligation of the CTP to different proteins, resulted in increasing of the in vivo half- life and bioactivity.

Structure-Function of hTSH N N  Subunit N hTSH  Sununit 3

Carbohydrate Recognition Carbohydrate Recognition Signal Signal  N -linked Oligosacharides Asn – X – Ser/Thr  O -linked oligosacharides Ser/Thr

hTSH Variants C H O C H O  - W T N H 2 ....... A s n -X -T h r ...... A s n - X -T h r ... 5 2 7 8 C H O  - 1 N H 2 ....... A s p -X -T h r ...... A s n - X -T h r ... 5 2 7 8 C H O  - 2 N H 2 ....... A s n - X - T h r ...... A s p - X - T h r ... 5 2 7 8  -1 + 2 N H 2 ....... A s p - X -T h r ...... A s p - X -T h r ... 5 2 7 8 C H O T S H  - W T N H 2 ...... A s n - X -T h r ...... 2 3

hTSH Mutants Mutants hTSH  Expressed in CHO Cells  Bioactivity was detected by measuring the ability of the hTSH to stimulate cAMP formation and T3 secretion from cultured human thyroid follicles.

hTSH Mutants Mutants hTSH  Reduction in the protein secretion  No effect on receptor binding  Reduction in biological activity

hTSH Single Chain Single Chain hTSH N N N hTSH  Gene  Gene hTSH   N o o o o N N hTSH  Gene  Gene CTP hTSH  CTP 

A. TSH  1 2 . . 3 4 TSH  xon 2 TSH  Exon 3  Exon 2  Exon 3  Exson 4 BamHI Sal I . TTT TCT GTC GCT CCT GAT Phe Ser Val Ala Pro Asp 136 137 138 1 2 3 TSH  Exon 3  Exon 2 B. TSH  CTP  5 1 4 6 TSH  Exon 2 TSH  Exon 3 CG  CTP  Exon 2  Exon 3  Exon 4 BamHI Sal I TTT TCT GTC TCC TCT TCC --- CTC CCA CAA GCT CCT GAT Phe Ser Val Ser Ser Ser --- Leu Pro Gln Ala Pro Asp 136 137 138 118 119 120 --- 143 144 145 1 2 3 TSH  Exon 3 CG  CTP  Exon 2

hTSH Single Chain  Expressed in CHO cells  Binds to TSH Receptor in high affinity as will as the TSH-WT  Biologically active

hTSH – – Single Chain Variants Single Chain Variants hTSH N o o o o  . hTSH  Gene  Gene CTP hTSH  CTP  1+2 o o o o hTSH  Gene  Gene CTP hTSH  CTP  deg

Secretion of TSH variants Secretion of TSH variants 48K 38K 25K  CTP  WT   CTP   +2  CTP  (deg) Dimer WT  W T

Receptor Binding TSH (WT) Receptor Binding TSH (WT) 120 dimer dimer β CTP, α dimer bCTP,a 100 125 I bTSH Bound (%) dimer bCTPa WT β CTP α WT(sc) 80 baWT β α WT(sc) 60 IC 50 (  U/ml) variant value 40 hTSH dimer 200 WT hTSH  CTP,  200 20 dimer hTSH  CTP  100 hTSH  10 0 0.1 1 10 100 1000 10000 hTSH variants (  u/ml)

Receptor Binding TSH (Mutants) Receptor Binding TSH (Mutants) 120 dimer dimer β CTP α 1+2 (sc) 100 bCTPa1+2 125 I bTSH Bound (%) β CTP α (deg) (sc) bCTPa(deg) 80 60 IC 50 (  U/ml) 40 variant value hTSH dimer WT 200 20 hTSH  CTP   18 hTSH  CTP  deg  100 0 0.1 1 10 100 1000 10000 TSH variants (  u/ml)

In vitro Bioactivity 100 1 סידרה β CTP α 2 סידרה 80 β CTP α 1+2 /well) pmol/well) β CTP α (deg) 3 סידרה 60 (pmol 40 cAMP( cAMP 20 0 0.1 1 10 100  U (  hTSH ( U/ml) /ml) hTSH

In vitro Bioactivity 100 1 סידרה β CTP α 2 סידרה 80 /well) β CTP α 1+2 pmol/well) β CTP α (deg) 3 סידרה (pmol 60 cAMP( cAMP 40 20 0 0.1 1 10 100  u (  hTSH ( u/ml) /ml) hTSH

TSH Antagonist IC 50 (  U/ml) cAMP(pmol/well) 120 variant value 80 hTSH  CTPa1+2 70 40 hTSH+ β CTP α 1+2 2 סידרה 3 סידרה hTSH+ β CTP α (deg) hTSH  CTPa(deg) 158 0 0.1 1 10 100 1000 hTSH(50  u/ml)+hTSH variants (  u/ml) T 3 (fmo/well) 2000 1600 variant value 1200 hTSH  CTPa1+2 33 800 hTSH+ β CTP α 1+2 2 סידרה 400 hTSH+ β CTP α (deg) 3 סידרה hTSH  CTPa(deg) 135 0 0.1 1 10 100 1000 hTSH(50  u/ml)+hTSH variants (  u/ml)

TSH Antagonist TSH Antagonist 100 hTSI+  CTP  1+2 1 סידרה cAMP(pmol/well) 2 סידרה hTSI+  CTP  deg) 80 60 40 20 0 0.1 1 10 100 1000 hTSI (0.75  u/ml)+hTSH variants (  u/ml) 2500 1 סידרה hTSI+  CTP  1+2 2000 2 סידרה hTSI+  CTP  deg) T 3 (fmol/well) 1500 1000 500 0 0.1 1 10 100 1000 hTSI (0.75  u/ml)+hTSH variants (  u/ml)

G- -protein protein cellular responses: cellular responses: G hTSH/ hTSI