Delegates Assembly Membership Update October 28, 2020 Lostant - PowerPoint PPT Presentation

Feb 24, 2024 •217 likes •308 views

Delegates Assembly Membership Update October 28, 2020 Lostant Community Library - Update New Member | Basic Online La Salle County Sierra Training Social Media Share any content about what is happening at your library by

Delegates Assembly Membership Update October 28, 2020
Lostant Community Library - Update • New Member | Basic Online • La Salle County • Sierra Training
Social Media • Share any content about what is happening at your library by emailing Elizabeth Smith elizabeth.smith@railslibraries.info. • Facebook @PrairieCatLibraries • Twitter @PrCatLib • Newsletter 400+ subscribers https://support.prairiecat.info/newsletter
PUG Day Webinar Series • 17 Sessions • 8 Sessions hosted by PrairieCat Libraries • Session recordings are available to view on-demand on the PrairieCat website: https://support.prairiecat.info/conference
PUG Day Webinar Series • 643 Total Live Session Attendance • 38 Average Attendance per Session • 71 Libraries Participated | 52% • 464 On Demand Views (10/2/2020) • Instructions to View Recordings
Save the Date | Member Update • Wednesday, Nov 18, 2020 2:00 pm - 4:00 pm • https://railslibraries.zoom.us/webinar/registe r/WN_H7OueMvmTPutH2CiKI-6Ww
Strategic Planning • Thank you for your participation! • Next Steps • Administrative Council Review • Plan presented at January Delegates Assembly

Download Presentation

Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

ISPRM ASSEMBLY OF DELEGATES ! Approval of Minutes of the Berlin Germany, 2015 Assembly of

ISPRM Assembly of Delegates May 29 th to June 2 nd Kuala Lumpur, Malaysia MINUTES Assembly of Delegates Wednesday June 1 st , 2016 15:00 18:30 Kuala Lumpur, Malaysia Agenda item timing 1. Introduction 10 a. Welcome & last minute

652 views • 27 slides

44 th MedCruise General Assembly Thursday, 22 nd May 2014 Castell n, Spain Stavros Hatzakos

44 th MedCruise General Assembly Thursday, 22 nd May 2014 Castell n, Spain Stavros Hatzakos 44th General Assembly - Castell n GA Participants o 44 Port Members 71 Delegates o 12 Associate Members 19 Delegates o 7 Cruise Lines

1.28k views • 98 slides

HyResponder Train the Trainer A programme in hydrogen safety for first responders CTIF

Responding to Hydrogen Fires HyResponder HyResponder Train the Trainer A programme in hydrogen safety for first responders CTIF Delegates Assembly Martigny 19 July 2019 1 Switzerland HyResponder CTIF Delegates Assembly Martigny 19 July

307 views • 18 slides

Assembly District Election Meeting Training November 2019 January 12 or 13, 2019 and January 26

Assembly District Election Meeting Training November 2019 January 12 or 13, 2019 and January 26 or 27, 2019 Elections held in all 80 Assembly Districts 14 delegates per Assembly District are elected (7 self-identified female / 7

417 views • 28 slides

Lecture 5: Delegates, Events and GUI Lisa (Ling) Liu Overview Delegates Events GUI

Chair of Softw are Engineering C# Programming in Depth Prof. Dr. Bertrand Meyer March 2007 May 2007 Lecture 5: Delegates, Events and GUI Lisa (Ling) Liu Overview Delegates Events GUI C# programming lecture 5: Delegates,

1.11k views • 42 slides

Health Policy Institute Dr. Neha Shanker, MPH 2019-2020 Delegate Tony Bridges House of Delegates

Health Policy Institute Dr. Neha Shanker, MPH 2019-2020 Delegate Tony Bridges House of Delegates 41 43 Maryland General Assembly Democrat, 41st district, Baltimore City 45 40 Member of: 46 44A o Appropriations Committee o Environment and

343 views • 6 slides

DELEGATE ASSEMBLY National Association of Social Workers Purpose Set broad organizational

DELEGATE ASSEMBLY National Association of Social Workers Purpose Set broad organizational policy Establish program priorities Develops collective stance on public and professional issues The 277 Delegates Elected by each chapter

385 views • 15 slides

Madame President, Distinguished Delegates, Ladies and Gentleman On the cenotaph in the Peace Park

Ms. Setsuko Thurlow Nuclear Non-Proliferation Review Conference NGO Presentation to the Delegates United Nations, New York 1 May 2015 Check Against Delivery Madame President, Distinguished Delegates, Ladies and Gentleman On the cenotaph in

360 views • 3 slides

Joint Crisis Committee Briefing to delegates 20 May 2013 Introduction What is the JCC?

Joint Crisis Committee Briefing to delegates 20 May 2013 Introduction What is the JCC? Why is JCC cool/special? Each council has: 20 delegates 2 chairs (head and vice) 2 secretaries Background Info

402 views • 23 slides

Service Conference CER Delegates to Conference Contact us: delegates@alcoholics-anonymous.eu 1

The General Service Conference CER Delegates to Conference Contact us: delegates@alcoholics-anonymous.eu 1 The General Service Conference | CER Delegates to Conference | Version 1.0 | November 2016 Agenda The General Service Conference a.

736 views • 48 slides

Events and Delegates & Gui Programming January 23, 2008 Events and Delegates 1 Gui

Events and Delegates & Gui Programming January 23, 2008 Events and Delegates 1 Gui Programing 2 1/23 Event Driven Programming Imagine a game with many actors responding to their environment. 2/23 Event Driven Programming Imagine a

753 views • 28 slides

Welcoming the Delegates to the Inaugural Workshop on IISC Reception Table Welcoming the

Welcoming the Delegates to the Inaugural Workshop on IISC Reception Table Welcoming the Delegates to the Inaugural Workshop on IISC Day 1 Opening Remarks by Dean of Schulich School of Engineering Welcoming the Delegates to the Inaugural

308 views • 15 slides

Summary of the Actions of the ASHP House of Delegates June 12 and 14, 2016 The House of

Summary of the Actions of the ASHP House of Delegates June 12 and 14, 2016 The House of Delegates Ultimate authority over ASHP professional policies ______________________________ One annual session consisting of 4 meetings: 2 meetings at

387 views • 19 slides

Winstronics ELECTRONIC ASSEMBLY MANUFACTURING 2016 PRESENTATION W W W . W I N S T R O N I C S .

Winstronics ELECTRONIC ASSEMBLY MANUFACTURING 2016 PRESENTATION W W W . W I N S T R O N I C S . C O M Winstronics Assembly Offering Wire Harness Assembly Overmolded Cables/USB/HDMI Coil Cords Printed Circuit Board Assembly

814 views • 32 slides

Assembly Language Introduction Learning Objectives Explain what assembly language is

Assembly Language Introduction Learning Objectives Explain what assembly language is Define Registers Instruction Operands Produce assembly from C 9/22/2015 CS61 Fall 2015 1 What is assembly? Yet another layer

450 views • 7 slides

Objectives What are assembly occupancies? Review the assembly use requirements in IBC

April 2019 Assembly Use and Occupancies Spring 2019 Career Development Series Milton Gregory Grew, AIA DAS Office of Education and Data Management Architect / Building Official / Codes Consultant 2 Objectives What are assembly

991 views • 97 slides

Cdigo funcional em Java: Superando o hype Eder Ignatowicz @ederign Lambda Expressions 101

Cdigo funcional em Java: Superando o hype Eder Ignatowicz @ederign Lambda Expressions 101 Dora Bento <3 Jesse "Pinkman" public Pug( String nome, String color, Integer size ) { this.nome = nome; this.color = color;

1.39k views • 114 slides

Getting a bill through Congress When is compromise a good thing? Small group exercise Ponder

10/2/18 Getting a bill through Congress When is compromise a good thing? Small group exercise Ponder these topics for 15 minutes: (You dont have to come to agreement!) CCLs rate of increase in the fee Protects the poor 100%

174 views • 3 slides

Youth Soccer Training Slides: A Math and Science Youth Soccer Training Slides: A Math and Science

MNUGJKZNFZAW ~ Book Youth Soccer Training Slides: A Math and Science Approach Youth Soccer Training Slides: A Math and Science Youth Soccer Training Slides: A Math and Science Approach Approach Filesize: 2.03 MB Reviews Reviews The ebook

455 views • 3 slides

A4 Great West Road Section-106 Pedestrian Improvements Will Miller, Better Routes & Places

Heading A4 Great West Road Section-106 Pedestrian Improvements Will Miller, Better Routes & Places Nigel Pompilis, Traffic Directorate Thursday 2 nd September 2010 Heading Funding 520k available from a number of developers, held

312 views • 16 slides

Machine Translation May 28, 2013 Christian Federmann Saarland University

Machine Translation May 28, 2013 Christian Federmann Saarland University cfedermann@coli.uni-saarland.de Language Technology II SS 2013 Decoding The decoder uses source sentence f and phrase table to estimate P(e|f) uses LM

670 views • 30 slides

Can You Afford Not To? Au Augu gust 1 13 th th , 201 2019 Chris ristoph pher B Bro rown

Can You Afford Not To? Au Augu gust 1 13 th th , 201 2019 Chris ristoph pher B Bro rown Colle llectio ion S System M Manager Oro ro Loma Sanit itary ry Dis Distri rict 30 years in construction and plumbing and under ground

425 views • 16 slides

Rfam Faster Genome Annotation of Input (hand-tuned): IRE (partial seed alignment):

Rfam Faster Genome Annotation of Input (hand-tuned): IRE (partial seed alignment): Non-coding RNAs Without MSA Hom.sap. GUUCCUGCUUCAACAGUGUUUGGAUGGAAC Hom.sap. UUUCUUC.UUCAACAGUGUUUGGAUGGAAC SS_cons Loss of Accuracy Hom.sap.

266 views • 5 slides

FairRoot Status &

FairRoot Status & Plans M. Al-Turany 12/3/13 GSI + FAIR Compu@ng Mee@ng

427 views • 26 slides