CEE 697z
Organic Compounds in Water and Wastewater
Cyanotoxins qPCR Method Prepared and presented by Kristie Stauch-White
CEE 697z - Lecture #29
Print version
Lecture #29
CEE 697z Organic Compounds in Water and Wastewater Cyanotoxins - - PowerPoint PPT Presentation
Print version CEE 697z Organic Compounds in Water and Wastewater Cyanotoxins qPCR Method Prepared and presented by Kristie Stauch-White Lecture #29 CEE 697z - Lecture #29 qPCR Quantification of Microcystis during Lake Erie Blooms in 2003 and
CEE 697z - Lecture #29
Lecture #29
LANDSAT 7 Image of Western Basin of Lake Erie near the mouth of the Maumee River
Maumee River
Rinta-Kanto, 2005
qPCR Quantification of Microcystis during Lake Erie Blooms in 2003 and 2004
CEE 697z - Lecture #29
Anabaena Oscillatoria Agardhii
CEE 697z - Lecture #29
CEE 697z - Lecture #29
CEE 697z - Lecture #29
Direct Competitive ELISA using Polyclonal Antibody
the antibody on the microtiter plate.
to MCYST concentration (lighter color = higher MCYST concentration)
http://www.jove.com/science-education/5061/the-elisa-method CEE 697z - Lecture #29
CEE 697z - Lecture #29
and threonin phosphatases (PP1 and PP2A)
(pNPP) – commonly used substrate for alkaline phosphatases
NODLNs – therefore based on functional activity rather than structure
CEE 697z - Lecture #29
mcyB 2959F mcyB 3278R TGGGAAGATGTTCTTCAGGTATCCAA AGAGTGGAAACAATATGATAAGCTAC 26 bp each, PCR product 60 – 1600 bp Wikipedia
Primers:
60oC
CEE 697z - Lecture #29
Rinta-Kanto, 2005
CEE 697z - Lecture #29
*
*Toxin detected, but toxin-producing genes not detected at this site
*
* Neither toxin producing gene found at this site, but microcystin detected (see Table 3)
Rinta-Kanto, 2005
CEE 697z - Lecture #29
Applied Biosystems
CEE 697z - Lecture #29
Bio-Rad
P = I * En
P is PCR product amount I is initial quantity of DNA E is PCR efficiency N is number of cycles
CEE 697z - Lecture #29
Eff = 10^(-1/slope) Eff% = ((10^(-1/slope))-1)*100%
CEE 697z - Lecture #29
Rinta-Kanto, 2005
CEE 697z - Lecture #29
CEE 697z - Lecture #29