“BUILD A GENOME” Designing and Synthesizing Sc2.0 Chris Von Dollen, Rose Xie, Yuan Guo, Pablo Lee, James DiCarlo, Ingrid Spielman Johns Hopkins University Saturday, October 31, 2009
Outline Chris Why Build Synthetic Yeast? Rose The Build a Genome Course Yuan Improving Build a Genome Workflow / Side Project #1 James Build a Genome Standard - RFC38, Genome Stabilization / Side Project #2, 3 Custom Software / Side Project #4 Pablo Chris Genome Shuffling Ingrid Deliverables Saturday, October 31, 2009
MEET Sc2.0 ( Saccharomyces cerevisiae ) Saturday, October 31, 2009
Not Your Average Yeast • Custom blueprint • Remove junk DNA • Cut out introns • Add loxPsym sites • Reorganize tRNA genes Saturday, October 31, 2009
Replacing Native Yeast Sequence With Synthetic DNA Chromosome 9 R One 90 kb piece CEN9 CEN9 Non-essential ORF Uncharacterized ORF Removed pseudogene Removed Ty1 LTR TAG > TAA loxPsym Essential ORF Dubious ORF Removed tRNA(I) PCRTag Saturday, October 31, 2009
Replacing Native Yeast Sequence With Synthetic DNA Chromosome 9 R One 90 kb piece CEN9 CEN9 Non-essential ORF Uncharacterized ORF Removed pseudogene Removed Ty1 LTR TAG > TAA loxPsym Essential ORF Dubious ORF Removed tRNA(I) PCRTag Saturday, October 31, 2009
Uh... So Where is this Going? • Fully synthetic eukaryotic genome (a first) • Streamlined custom organism • Minimal genome 'goal seek' • BioBrick and Device chassis • Map gene relationships • Distill the rules of genome structure Saturday, October 31, 2009
BUILD A GENOME COURSE Rose Xie Saturday, October 31, 2009
Goals Saturday, October 31, 2009
Goals • Low cost undergraduate labor (i.e. FREE) Saturday, October 31, 2009
Goals • Low cost undergraduate labor (i.e. FREE) • Hands-on lab experience • Exposure to cutting edge research • Develop independence • Gain presentation and speaking skills Saturday, October 31, 2009
Goals • Low cost undergraduate labor (i.e. FREE) • Hands-on lab experience • Exposure to cutting edge research • Develop independence • Gain presentation and speaking skills • Build the starting materials for Sc2.0 Saturday, October 31, 2009
Lectures • Fundamental genetics • Bioinformatics • Central concepts of synthetic biology: recombinant DNA technology, gene synthesis, etc. • Bioethics • Economics Saturday, October 31, 2009
Boot Camp • 8 Sessions • Master lab techniques • Milestones • First lab meeting Saturday, October 31, 2009
Independence! • Each student assigned ~12 building blocks for a total of 10,000 bp • Each student gets their own key to the laboratory • Regular “lab meetings” held (mini-presentations, troubleshooting) Saturday, October 31, 2009
Working hard… Saturday, October 31, 2009
But really… Saturday, October 31, 2009
Evaluation/Results • Ability to synthesize assigned building blocks: ~9 out of 12 • Number of perfect clones (“winners”): typically 3 out of 12 Saturday, October 31, 2009
First pass of chromosome 3 completed! Pass Pending Saturday, October 31, 2009
Over 50 B-A-G Grads! Saturday, October 31, 2009
Beyond Build-a-Genome • B-A-G Mentors! • Side projects (up next!) • Job opportunities! • “The Mosh Pit” business competition: 2 BAG graduates won 2 nd prize = $10,000! Saturday, October 31, 2009
Beyond Build-a-Genome • B-A-G Mentors! • Side projects (up next!) • Job opportunities! • “The Mosh Pit” business competition: 2 BAG graduates won 2 nd prize = $10,000! • World domination?! Saturday, October 31, 2009
Beyond Build-a-Genome • B-A-G Mentors! • Side projects (up next!) • Job opportunities! • “The Mosh Pit” business competition: 2 BAG graduates won 2 nd prize = $10,000! • World domination?! Make Build-a-Genome replicate Saturday, October 31, 2009
IMPROVEMENTS IN B-A-G PROTOCOLS Zheyuan Guo Saturday, October 31, 2009
3L ~ 110 kbp Chromosome 3 ~330 kbp 1 2 3 A B C D 4 X ~28 kbp 4 5 B1 B2 B3 15 X ~750 bp BB B2.1 B2.2 B2.3 B2.4 B2.5 B2.6 B2.7 B2.16 tPCR 16 X ~70 nt (nucleotides) AACTTCGTCAGTATCAGCTTTATCCTTATCACCCACATCAGCCATAAATATTAGCTCCAAAAGTTTGAG Saturday, October 31, 2009
Typical B-A-G Work Flow Saturday, October 31, 2009
Typical B-A-G Work Flow TRANSFORMATION csPCR SEQUENCING tPCR fPCR GEL GEL 1 st week 3 rd week Saturday, October 31, 2009
Typical B-A-G Work Flow TRANSFORMATION csPCR SEQUENCING tPCR fPCR GEL GEL 1 st week 3 rd week PROBLEM 1 tPCR fPCR GEL 2-3 Iterations 1 week Saturday, October 31, 2009
Typical B-A-G Work Flow TRANSFORMATION csPCR SEQUENCING tPCR fPCR GEL GEL 1 st week 3 rd week PROBLEM 1 tPCR fPCR GEL 2-3 Iterations 1 week PROBLEM 2 SEQUENCING csPCR GEL TRANSFORMATION 6 th week 5 th week Saturday, October 31, 2009
Problem #1 t-PCR (“Templateless”) Oligonucleotide Assembly • Process of going from 70 bp oligos to 750 bp products • Gapped Overlapping Regions: • Good news!! Works ~70% of the time • But when you don’t get desired product… • Go back and start over • More money for reagents • More HOURS are lost in the Lab! Saturday, October 31, 2009
Alternative to t-PCR LCR (Ligase Chain Reaction) Taq Ligase Taq Ligase Optimizations • Taq ligase • Good: Complete overlap: higher • T4 ligase frequency of successful building • 9 degrees north blocks increases • Pfu ligase • Different PCR cycling times, annealing temperatures • Bad: Costs more due to more • Different dilutions • Enzyme concentrations oligos • DNA concentrations Saturday, October 31, 2009
Failed LCR Failed Passed Standard LCR PCR Passed Standard PCR Ligase Chain Reaction Method (LCR) 85% of failed standard PCR produced full length products by LCR Helps save TIME and MONEY! Saturday, October 31, 2009
Problem #2 Point mutations from oligos • Oligos have a 1% error rate per base • Requires sequencing multiple (12-18) clones of BBs to identify “winners” Saturday, October 31, 2009
Taq MutS Protein to the Rescue! Taq MutS Optimizations • Taq MutS protein binds to • MutS mismatched pairs of heteroduplex • Different tags DNA • DNA protein ratios • Binding temperature • Magnesium concentration in buffer • Enriches DNA population for • Binding time homoduplexes (non-mutant DNAs) Saturday, October 31, 2009
Overall Fidelity t-PCR/f-PCR vs LCR/f-PCR # Mutations / ions / 1,000 bp t-‑PCR/f-‑PCR LCR/f-‑PCR 2.6 2.1 Taq MutS # Mutations / ions / 1,000 bp MutS ¡Untreated MutS ¡Treated 4.4 2.2 Saturday, October 31, 2009
Bottom line • LCR leads to a higher success rate • LCR increase fidelity slightly • MutS may increase fidelity Saturday, October 31, 2009
Optimizations Saturday, October 31, 2009
BUILDING BLOCK ASSEMBLY James DiCarlo Saturday, October 31, 2009
Modifying Building Block Ends A (N x ) U A (N x ) T Building Block T (N x ) A U (N x ) A x = 3 - 11 bp Saturday, October 31, 2009
Building Block Assembly 5’ AAAAUG TAAGGT Protein Coding Sequence TTTTAC AUTCCA 3’ 5’ 5’ AAATAAT AAAAT AAGGU AAATAAT Promoter Terminator TTTATTA UTTTA TTCCA TTTATTA 3’ 3’ Saturday, October 31, 2009
After USER 5’ AAAA U G TAAGGT Protein Coding Sequence TTTTAC A U TCCA 3’ 5’ 5’ AAATAAT AAAAT AAGG U AAATAAT Promoter Terminator TTTATTA U TTTA TTCCA TTTATTA 3’ 3’ Saturday, October 31, 2009
After USER 5’ AAAA G TAAGGT Protein Coding Sequence TTTTAC A TCCA 3’ 5’ 5’ AAATAAT AAAAT AAGG AAATAAT Promoter Terminator TTTATTA TTTA TTCCA TTTATTA 3’ 3’ Saturday, October 31, 2009
After USER 5’ G TAAGGT Protein Coding Sequence TTTTAC A 3’ 5’ 5’ AAATAAT AAAAT AAATAAT Promoter Terminator TTTATTA TTCCA TTTATTA 3’ 3’ Saturday, October 31, 2009
Ligation and Repair G TAAGGT Protein Coding Sequence TTTTAC A 5’ AAATAAT AAAAT AAATAAT Promoter Terminator TTTATTA TTCCA TTTATTA 3’ Saturday, October 31, 2009
Ligation and Repair 5’ AAATAAT AAAAT Promoter TTTATTA G TAAGGT Protein Coding Sequence 3’ TTTTAC A AAATAAT Terminator TTCCA TTTATTA Saturday, October 31, 2009
Ligation and Repair 5’ AAATAAT AAAAT Promoter TTTATTA G TAAGGT Protein Coding Sequence 3’ TTTTAC A AAATAAT Terminator TTCCA TTTATTA Bottom Line: Building blocks can only go together in one way Saturday, October 31, 2009
Ligation and Repair 5’ AAATAAT AAATAAT AAAAT G TAAGGT Terminator Protein Coding Sequence Promoter TTTTAC A TTCCA TTTATTA TTTATTA 3’ Bottom Line: Building blocks can only go together in one way Saturday, October 31, 2009
BioBrick vs Building Blocks • No restriction enzymes • No scars • Seamless • Single step multi-fragment assembly • Both are abbreviated BB Saturday, October 31, 2009
Building Blocks • No restriction enzymes • No scars • Seamless • Single step multi-fragment assembly Saturday, October 31, 2009
A New DNA Assembly Standard RFC 38 Saturday, October 31, 2009
Recommend
More recommend
