rob

Rob Niche Dimensions Edwards What would you do with hundreds of - PowerPoint PPT Presentation

UNAM The Global Evolution and 2012 Adaptation of Vibrio cholerae Across Multiple Rob Niche Dimensions Edwards What would you do with hundreds of genome sequences? Cholerae Haiti Global evolution Niche dimensions What's


  1. UNAM The Global Evolution and 2012 Adaptation of Vibrio cholerae Across Multiple Rob Niche Dimensions Edwards

  2. What would you do with hundreds of genome sequences? ● Cholerae ● Haiti ● Global evolution ● Niche dimensions ● What's important

  3. Cholera is caused by Vibrio cholerae

  4. A world wide pandemic About 3-5 million cases per year About 100 - 200,000 deaths world wide per year Notable deaths: ● Tchaikovsky ● Polk (11th President USA)

  5. Symptoms About 75% of patients have no symptoms 25-50 PINTS of diarrhea per DAY Severe symptoms are by dehydration Treatment Clean water Electrolytes Vaccine Not antibiotics

  6. Multiple Pandemics 1st – 1817 to 1823 Started at the Ganges, spread by colonialists 2nd – 1829 to 1849 Worldwide spread via immigrants 3rd – 1852 to 1859 John Snow first epidemiologist

  7. First epidemiological study John Snow Portrait painted in 1847 when he was 34 years old.

  8. First epidemiological study John Snow Cholera outbreak in Soho, London 1854 Plotted all cases on a map Found big cluster around water well

  9. First epidemiological study John Snow’s Map

  10. On the mode of communication of Cholera 1854

  11. Cholera caused by bacteria Outbreaks of cholera

  12. Multiple Pandemics 1st – 1817 to 1823 Started at the Ganges, spread by colonialists 2nd – 1829 to 1849 Worldwide spread via immigrants 3rd – 1852 to 1859 John Snow first epidemiologist 4th – 1863 to 1879 Originated in mecca 5th – 1881 to 1896 First cholerae vaccine (1892) 6th – 1899 to 1923 Killed 800,000 people 7th – 1961 to present ● 1991: South America killed > 100,000 people

  13. Haitian Outbreak Earthquake Jan 12th, 2010 No cholera in Haiti for > 50 years First case, October 22nd, 2010 By February, 2011 250,000 cases and ~5,000 deaths What was the original source?

  14. Haitian cholera outbreaks http://www.ph.ucla.edu/

  15. Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

  16. Cases by day – Mirebalais Hospital

  17. Cases by Age – St Marc Hospital On October 20th, 2010

  18. Haitian Outbreak Two hypotheses: Endemic, waterborne strain that has been in Haiti but not caused disease for 50 years Imported from another country

  19. The environmental hypothesis "They have been fortunate in Haiti that for 50 years the conditions have been such that they haven’t had an intense increase in cholera bacterial populations. ... But they’ve had an earthquake, they’ve had destruction, they’ve had a hurricane ... I think it’s very unfortunate to look for a scapegoat. It is an environmental phenomenon that is involved” Rita Colwell Johns Hopkins School of Public Health

  20. The human hypothesis “The organism that is causing the disease is very uncharacteristic of (Haiti and the Caribbean), and is quite characteristic of the region from where the soldiers in the base came. ... I don't see there is any way to avoid the conclusion that an unfortunate and presumably accidental introduction of the organism occurred." John Mekalanos Harvard Medical School

  21. Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

  22. Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

  23. Conditions favor human hypothesis Source: Final Report of the Independent Panel of Experts on the Cholera Outbreak in Haiti

  24. On the source of Haitian cholera Harveyi Parahemolyticus Mimicus Vibrio cholerae from Bangladesh in 1994 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Bangladesh in 2002 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Haiti in 2010 Cholerae

  25. Nepalese soldiers? Outbreak in Khatmandu, Nepal before the soldiers left Outbreaks downstream (not upstream) along the river from the nepalese UN camp But that could have come from river trade. Ships used to fly the yellow flag when they were quarantined by cholera

  26. Haitian cholera outbreaks http://www.ph.ucla.edu/

  27. Global evolution of Vibrio Can we use genomics to identify the Which gene(s) are important for temporal/spatial variation? global evolution of Vibrio?

  28. Prototype Vibrio cholerae sequence TIGR Nature 406, 477-483(3 August 2000)

  29. Sequenced genomes 2011 – 32 Vibrio strains sequenced

  30. Fabiano Thompson's Lab @ UFRJ

  31. Fundação Oswaldo Cruz

  32. Ion quality scores

  33. 2011 – 171 Vibrio strains sequenced Sequenced genomes 2011 – 32 Vibrio strains sequenced

  34. Reads per chromosome (Chr. I)

  35. Reads per chromosome (Chr. I)

  36. Cholera Toxin Phage

  37. Annotated using RAST

  38. Merge frameshifts ● Merge adjacent genes if: ● Have the same function ● Have similarity to the same 3 rd party protein

  39. Frameshift frequency

  40. Is it any good? Metabolic reconstruction considers the pathways present in the cell Based on comparison to Sanger sequenced V. cholerae El Tor strain (a virulent pathogen)

  41. R-18304 El T or (Ion) (Sanger)

  42. R-18304 El T or (Ion) (Sanger)

  43. Single nucleotide polymorphisms ATCATCGATCAGCATGCATCAGCATCGATCAGC ATCATCGATCAGCATGCATCAGCATCGATCAGC ATCATCGATCAGCATGCATCAGCCTCGATCAGC ATCATCGATCAGCATGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGATCAGC ATCATCGATCAGCAAGCATCAGCCTCGAGCAGC ATCATCGATCAGCAAGCATCAGCCTCGAGCAGC

  44. Global evolution Mutreja et al 2011

  45. Waves of spread of cholera Mutreja et al 2011

  46. Different evolution for each wave Mutreja et al 2011

  47. On the source of Haitian cholera Harveyi Parahemolyticus Mimicus Vibrio cholerae from Bangladesh in 1994 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Bangladesh in 2002 Vibrio cholerae from Haiti in 2010 Vibrio cholerae from Haiti in 2010 Cholerae

  48. Evolution not only by SNPs Conservation of the ~120 kb superintegron region across 210 strains

  49. Horizontal gene transfer versus Vertical evolution Mother S N HGT P s Daughter Daughter

  50. Niche dimensions ● 210 Vibrio genomes ● Year ● Continent ● Country ● Reassembled ● Lat/Lon Coordinates ● Clinical or Environmental ● Reannotated ● Source ● Serogroup ● Serotype ● Find interesting ● Biotype genes! ● Mutreja wave

  51. V. cholerae classification Vibrio cholerae Cholera toxin Non-cholera toxin O1 O139 Serogroup Classical Biotype El Tor Ogawa Inaba Serotype Epidemics No disease

  52. Niche dimensions ● 210 Vibrio genomes ● Year ● Continent ● Country ● Reassembled ● Lat/Lon Coordinates ● Clinical or Environmental ● Reannotated ● Source ● Serogroup ● Serotype ● Find interesting ● Biotype genes! ● Mutreja wave

  53. Response variables ● 15,000 genes in the pangenome ● 933 subsystems (pathways) present in at least one genome ● SNPs (after Mutreja)

  54. Analysis ● Recreate evolution of the Vibrios ● What are the important genes for each niche dimension Who, what, when, where! Use random forests to identify important variables

  55. Random Forest Exopoly- DNA O-antigen Capsule Sialic Acid saccharide recomb. 01 10 20 5 10 01 10 20 5 10 01 10 20 5 10 0139 100 1 8 10 0139 100 1 8 10 0139 100 1 8 10 0139 100 1 8 10

  56. Random Forest Exopoly- saccharide <50 DNA- recombination O1 Capsule 10 O139 <10 O1 O139 O1 O139

  57. Random Forest Each tree votes on the importance of each variable. Typically, run 10,000 trees

  58. Genes important for who ? (serogroup)

  59. Genes important for what? (clinical, environmental, ...)

  60. Genes important for where? (continent)

  61. Separation of functions by continent

  62. Genes important for when? (year) DNA Repair

  63. DNA repair & phages Normal DNA repair (134 strains) Additional DNA repair umuC umuD (4 strains; not O1) Phage borne DNA repair umuD umuC prophage umuC (72 strains)

  64. Different evolution for each wave Waves 2 & 3 have phage Interrupted repair Mutreja et al 2011

  65. Conclusions ● Unraveling evolution and spread of new pathogens ● Mining genomes and niche dimensions ● Don't get scooped!

  66. Discussion points ● What is the value of multi genome projects?

  67. Current multigenome projects Organism Number Organism Number S. pyogenes 3,615 Mycobacterium 390 tuberculosis S. pneumoniae 3,085 Salmonella in cattle 373 and humans Rice (Oryza sativa) 3,000 Vibrio 274 C. elegans 2,007 Shigella sonnei 263 Clostridium difficile 1,250 Mycobacterium 259 tuberculosis The thousand 1,092 Streptococcus 240 (human) genome pneumoniae project Mycobacterium 1,000 Methicillin-resistant 193 tuberculosis Staphylococcus aereus Plasmodium 825 Campylobacter 192 falciparum jejuni Streptococcus 616 Mycobacterium 170 pneumoniae abscessus in CF Nick Loman: http://lab.loman.net/

Recommend


More recommend