SLIDE 8 8
- 4. Sequence Comparison—Alignment
AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC
- AGGCTATCACCTGACCTCCAGGCCGA--TGCCC---
| | | | | | | | | | | | | x | | | | | | | | | | |
TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC
Sequence Alignment Introduced ~1970 BLAST: 1990, most cited paper in history Still very active area of research query DB BLAST Efficient string matching algorithms Fast database index techniques …, comparison of a 200-amino-acid sequence to the 500,000 residues in the National Biomedical Research Foundation library would take less than 2 minutes on a minicomputer, and less than 10 minutes
- n a microcomputer (IBM PC).
Lipman & Pearson, 1985
Database size today: 1012 (increased by 2 million folds). BLAST search: 1.5 minutes …, comparison of a 200-amino-acid sequence to the 500,000 residues in the National Biomedical Research Foundation library would take less than 2 minutes on a minicomputer, and less than 10 minutes
- n a microcomputer (IBM PC).
- 5. Microarray analysis
Clinical prediction of Leukemia type
– Acute lymphoid (ALL) – Acute myeloid (AML)
- Different treatments & outcomes
- Predict type before treatment?
Bone marrow samples: ALL vs AML Measure amount of each gene
Some goals of biology for the next 50 years
- List all molecular parts that build an organism
– Genes, proteins, other functional parts
- Understand the function of each part
- Understand how parts interact physically and functionally
- Study how function has evolved across all species
- Find genetic defects that cause diseases
- Design drugs rationally
- Sequence the genome of every human, use it for personalized
medicine
- Bioinformatics is an essential component for all the
goals above