Genomes and Complex Diseases 02-223 Personalized Medicine: - - PowerPoint PPT Presentation

Genomes ¡and ¡Complex ¡Diseases ¡

02-­‑223 ¡Personalized ¡Medicine: ¡ Understanding ¡Your ¡Own ¡Genome ¡ Fall ¡2014 ¡

Genome ¡Polymorphisms ¡

TCGAGGTATTAAC

The ¡ancestral ¡chromosome ¡

A Human Genealogy ¡

TCGAGGTATTAAC TCTAGGTATTAAC TCGAGGCATTAAC TCTAGGTGTTAAC TCGAGGTATTAGC TCTAGGTATCAAC * ** * *

From SNPS … ¡

A ¡disease ¡mutaCon ¡

Finding ¡Disease ¡Muta9ons ¡

• Case/control ¡data ¡are ¡collected ¡from ¡unrelated ¡individuals ¡

– All ¡individuals ¡are ¡related ¡if ¡we ¡go ¡back ¡far ¡enough ¡in ¡the ¡ancestry ¡

Balding, ¡Nature ¡Reviews ¡GeneCcs, ¡2006 ¡

Family-­‑Based ¡and ¡Popula9on-­‑Based ¡Studies ¡

• How ¡can ¡we ¡idenCfy ¡disease-­‑related ¡geneCc ¡loci? ¡
• Linkage ¡analysis ¡

– Data ¡are ¡collected ¡for ¡family ¡members ¡ – Difficult ¡to ¡collect ¡data ¡on ¡a ¡large ¡number ¡of ¡families ¡ – EffecCve ¡for ¡rare ¡diseases ¡

• Genome-­‑wide ¡associaCon ¡studies ¡(GWAS) ¡

– Data ¡are ¡collected ¡for ¡unrelated ¡individuals ¡ – Easier ¡to ¡find ¡a ¡large ¡number ¡of ¡affected ¡individuals ¡ – EffecCve ¡for ¡common ¡diseases, ¡compared ¡to ¡family-­‑based ¡ method ¡

Family-­‑Based ¡and ¡Popula9on-­‑Based ¡Studies ¡

• How ¡do ¡the ¡LD ¡pa]erns ¡in ¡genomes ¡differ ¡between ¡family ¡and ¡

populaCon ¡data? ¡

• Large ¡or ¡small ¡linked ¡regions? ¡
• ResoluCon ¡for ¡pinpoinCng ¡the ¡disease ¡locus? ¡ ¡

Linkage ¡Analysis ¡vs. ¡Associa9on ¡Analysis ¡

Strachan ¡& ¡Read, ¡Human ¡Molecular ¡GeneCcs, ¡2001 ¡

(Number ¡of ¡recombinaCon ¡sites) ¡ (shared ¡genome ¡segments ¡among ¡different ¡individuals ¡in ¡the ¡study) ¡

SNP ¡Genotyping ¡vs. ¡Whole ¡Genome ¡Sequencing ¡

• How ¡would ¡you ¡idenCfy ¡disease ¡mutaCons ¡using ¡whole ¡

genome ¡sequencing ¡technology? ¡

• How ¡would ¡you ¡idenCfy ¡disease ¡mutaCons ¡using ¡SNP ¡

genotyping ¡technology? ¡

How ¡Can ¡We ¡Iden9fy ¡the ¡Unknown ¡Disease ¡Locus? ¡

• Idea: ¡Given ¡a ¡map ¡of ¡SNP ¡geneCc ¡markers, ¡let’s ¡look ¡for ¡the ¡

markers ¡that ¡are ¡linked ¡to ¡the ¡unknown ¡disease ¡locus ¡(i.e. ¡ linkage ¡between ¡the ¡disease ¡locus ¡and ¡the ¡marker ¡locus) ¡

Disease ¡ ¡ Locus ¡ SNP ¡near ¡the ¡ disease ¡locus ¡ (r2>>0.5) ¡ SNPs ¡far ¡from ¡the ¡ disease ¡locus ¡ ¡ (r2<<0.5) ¡

Genome-­‑Wide ¡Associa9on ¡Study ¡(GWAS) ¡

• Data ¡are ¡collected ¡for ¡genotypes ¡and ¡phenotypes ¡for ¡a ¡large ¡

number ¡of ¡unrelated ¡individuals ¡

– Genotypes: ¡ ¡

• ofen ¡SNP ¡genotypes ¡are ¡used ¡because ¡of ¡the ¡ease ¡of ¡genotyping ¡

and ¡abundance ¡across ¡genomes. ¡

• For ¡SNPs, ¡minor ¡allele ¡homozygous, ¡heterozygous, ¡and ¡major ¡allele ¡

heterozygous ¡sites ¡are ¡coded ¡as ¡0, ¡1, ¡and ¡2. ¡ – Phenotypes: ¡ ¡

• Categorical ¡data ¡(e.g., ¡case/control ¡labels ¡for ¡individuals) ¡
• ConCnuous-­‑valued ¡data ¡(e.g., ¡height, ¡cholesterol ¡level, ¡blood ¡IgE ¡

level) ¡

Overview ¡

• Case ¡control ¡studies ¡

– Discrete ¡phenotype ¡ – Are ¡you ¡a ¡healthy ¡normal ¡or ¡a ¡paCent? ¡

• QuanCtaCve ¡trait ¡studies ¡

– ConCnuous-­‑valued ¡phenotypes ¡ – Height, ¡eye ¡color, ¡blood ¡pressure, ¡cholesterol ¡level, ¡body-­‑mass ¡index ¡

• etc. ¡

Genome-­‑Wide ¡Associa9on ¡Study ¡(GWAS) ¡

• Data ¡collected ¡for ¡GWAS ¡can ¡be ¡represented ¡as ¡two ¡matrices ¡

Genotype ¡Data ¡ ¡ Phenotype ¡Data ¡ N ¡individuals ¡ N ¡individuals ¡ J ¡SNPs ¡ ¡ K ¡phenotypes ¡

Genome-­‑Wide ¡Associa9on ¡Study ¡(GWAS) ¡

• For ¡each ¡SNP ¡and ¡each ¡phenotype, ¡perform ¡a ¡staCsCcal ¡test ¡

for ¡“associaCon” ¡ ¡

• Repeat ¡this ¡for ¡all ¡(SNP, ¡phenotype) ¡pairs ¡
• IdenCfy ¡the ¡(SNP, ¡phenotype) ¡pairs ¡with ¡“significant” ¡
• associaCon. ¡ ¡

– The ¡genome ¡region ¡around ¡the ¡SNP ¡is ¡likely ¡to ¡influence ¡the ¡ phenotype ¡

Genotype ¡Data ¡ Phenotype ¡Data ¡ N ¡individuals ¡ N ¡individuals ¡ J ¡SNPs ¡ ¡ K ¡phenotypes ¡ Are ¡the ¡SNP ¡and ¡the ¡phenotype ¡ significantly ¡associated? ¡

GWAS: ¡Case/Control ¡Study ¡

Genotype ¡Data ¡ N ¡individuals ¡ N ¡individuals ¡ J ¡SNPs ¡ ¡ One ¡phenotype ¡for ¡case/ control ¡labels ¡ Are ¡the ¡SNP ¡and ¡the ¡phenotype ¡ significantly ¡associated? ¡

GWAS: ¡Case/Control ¡Study ¡

• For ¡each ¡marker ¡locus, ¡find ¡the ¡

3x2 ¡conCngency ¡table ¡containing ¡ the ¡counts ¡of ¡three ¡genotypes ¡

• ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡test ¡with ¡2 ¡df ¡(degree ¡of ¡

freedom) ¡under ¡the ¡null ¡ hypothesis ¡of ¡no ¡associaCon ¡ ¡

Genotype Case Control Total AA Ncase,AA Ncontrol,AA NAA Aa Ncase,Aa Ncontrol,Aa NAa aa Ncase,aa Ncontrol,aa Naa Total Ncase Ncontrol N

Genotype ¡score ¡= ¡the ¡number ¡of ¡minor ¡alleles ¡ ¡

2

χ

GWAS: ¡Case/Control ¡Study ¡

• AlternaCvely, ¡assume ¡an ¡addiCve ¡model, ¡where ¡the ¡

heterozygote ¡risk ¡is ¡approximately ¡between ¡the ¡two ¡ homozygotes ¡

• Form ¡a ¡2x2 ¡conCngency ¡table. ¡Each ¡individual ¡contributes ¡

twice ¡from ¡each ¡of ¡the ¡two ¡chromosomes. ¡

• ¡ ¡ ¡ ¡ ¡ ¡test ¡with ¡1df ¡

Allele Type Case Control Total A Gcase,A Gcontrol,A GA a Gcase,a Gcontrol,a Ga Total 2xNcase 2xNcontrol 2N

2

χ

Test ¡(Chi-­‑square ¡Test) ¡

• StaCsCcal ¡test ¡of ¡associaCon ¡
• In ¡case/control ¡associaCon ¡study, ¡the ¡null ¡hypothesis ¡is ¡ ¡

¡ H0: ¡There ¡is ¡no ¡associaCon ¡between ¡the ¡given ¡marker ¡and ¡disease ¡labels. ¡

• P-­‑value ¡= ¡probability ¡of ¡the ¡observed ¡data ¡under ¡the ¡null ¡hypothesis ¡
• Low ¡p-­‑value ¡(p-­‑value ¡< ¡α, ¡where ¡α ¡is ¡a ¡user-­‑specified ¡value) ¡means ¡

the ¡observed ¡data ¡are ¡unlikely ¡under ¡the ¡null ¡hypothesis. ¡Thus, ¡we ¡ reject ¡the ¡null ¡hypothesis ¡(H0) ¡and ¡declare ¡there ¡is ¡a ¡significant ¡ associaCon ¡between ¡the ¡SNP ¡and ¡disease ¡states. ¡

– Ofen ¡α=0.01 ¡or ¡0.05 ¡is ¡used. ¡

2

χ

Chi-­‑Square ¡Test: ¡Null ¡Hypothesis ¡from ¡ Con9ngency ¡Table ¡

• We ¡have ¡two ¡random ¡variables: ¡

– Y: ¡disease ¡status ¡(Case/Control) ¡ – X: ¡allele ¡type ¡(A/a) ¡

• Null ¡hypothesis: ¡the ¡two ¡variables ¡are ¡

independent ¡of ¡each ¡other ¡(i.e., ¡the ¡two ¡ variables ¡are ¡unrelated) ¡ Allele Type Case Control Total A Gcase,A Gcontrol,A GA a Gcase,a Gcontrol,a Ga Total 2xNcase 2xNcontrol 2N

Chi-­‑Square ¡Test ¡

Allele Type Case Control Total A Gcase,A Gcontrol,A GA a Gcase,a Gcontrol,a Ga Total 2xNcase 2xNcontrol 2N Allele Type Case Control Total A ? ? GA a ? ? Ga Total 2xNcase 2xNcontrol 2N ObservaCons ¡ Expected ¡values ¡

Chi-­‑square ¡sta9s9c ¡

χ 2 = (Oi − Ei)2 Ei

i=1 n

∑

Oi ¡= ¡observed ¡frequency ¡for ¡ith ¡outcome ¡ ¡ ¡ (the ¡value ¡can ¡be ¡read ¡off ¡of ¡the ¡conCngency ¡table) ¡ Ei ¡= ¡expected ¡frequency ¡for ¡ith ¡outcome ¡ ¡ ¡ (the ¡value ¡can ¡be ¡obtained ¡as ¡described ¡in ¡the ¡previous ¡slides) ¡ n ¡= ¡total ¡number ¡of ¡outcomes ¡ The ¡probability ¡distribuCon ¡of ¡this ¡staCsCc ¡is ¡given ¡by ¡the ¡ chi-­‑square ¡distribuCon. ¡ Using ¡chi-­‑square ¡test, ¡we ¡can ¡test ¡how ¡well ¡observed ¡values ¡fit ¡expected ¡values ¡ computed ¡under ¡the ¡independence ¡hypothesis ¡ α= ¡

Test ¡staCsCc= ¡

Chi-­‑Square ¡Test: ¡How ¡to ¡Compute ¡Expected ¡ Values ¡

• Under ¡the ¡null ¡hypothesis ¡of ¡ ¡

independence ¡ ¡

– P(Y=case ¡and ¡X=A)= ¡P(Y=case)P(X=A) ¡

• Under ¡the ¡null ¡hypothesis, ¡the ¡expected ¡

number ¡of ¡cases ¡with ¡allele ¡A ¡is ¡

– 2N ¡x ¡P(Y=case)P(X=A) ¡ – where ¡N ¡is ¡total ¡observaCons ¡and ¡

¡ ¡ ¡ ¡ ¡ P(Y=case)=(Gcase,A+Gcase,a)/(2N) ¡ ¡ ¡ ¡ P(X=A)=(Gcase,A+ ¡Gcontrol,A)/(2N) ¡

• Similarly ¡ ¡

– What ¡is ¡the ¡expected ¡number ¡of ¡cases ¡with ¡ allele ¡a? ¡ – What ¡is ¡the ¡expected ¡number ¡of ¡controls ¡with ¡ allele ¡A? ¡ – What ¡is ¡the ¡expected ¡number ¡of ¡controls ¡with ¡ allele ¡a? ¡

• Do ¡the ¡probabiliCes ¡sum ¡to ¡1? ¡

Allele Type Case Control Total A Gcase,A Gcontrol,A GA a Gcase,a Gcontrol,a Ga Total 2xNcase 2xNcontrol 2N Allele Type Case Control Total A ? ? GA a ? ? Ga Total 2xNcase 2xNcontrol 2N ObservaCons ¡ Expected ¡values ¡

Chi-­‑square ¡Sta9s9c ¡

Case Control A 16 36 a 2 48

• ¡Compute ¡expected ¡values ¡
• ¡Compute ¡chi-­‑square ¡staCsCc ¡
• ¡Compute ¡chi-­‑square ¡ ¡

p-­‑value ¡by ¡referring ¡to ¡ chi-­‑square ¡distribuCon ¡

ManhaUan ¡Plot ¡of ¡p-­‑values ¡from ¡Breast ¡Cancer ¡ GWAS ¡

• Analysis ¡of ¡582,886 ¡SNPs ¡for ¡3,659 ¡cases ¡with ¡family ¡history ¡

and ¡4,897 ¡controls ¡

Nature ¡GeneCcs ¡42, ¡504-­‑507 ¡(2010) ¡

High ¡associaCon ¡

Ofen ¡ ¡–log10 ¡(p-­‑value) ¡is ¡ plo]ed ¡instead ¡of ¡ p-­‑value. ¡

Correc9ng ¡for ¡Mul9ple ¡Tes9ng ¡

• What ¡happens ¡when ¡we ¡scan ¡the ¡genome ¡of ¡1 ¡million ¡markers ¡

for ¡associaCon ¡with ¡α ¡= ¡0.05? ¡

– 50,000 ¡(=1 ¡millionx0.05) ¡SNPs ¡are ¡expected ¡to ¡be ¡found ¡significant ¡just ¡ by ¡chance ¡ – We ¡need ¡to ¡be ¡more ¡conservaCve ¡when ¡we ¡decide ¡a ¡given ¡marker ¡is ¡ significantly ¡associated ¡with ¡the ¡trait. ¡

• CorrecCon ¡methods ¡

– Bonferroni ¡correcCon ¡

Overview ¡

• Case ¡control ¡studies ¡

– Discrete ¡phenotype ¡ – Are ¡you ¡a ¡healthy ¡normal ¡or ¡a ¡paCent? ¡

• QuanCtaCve ¡trait ¡studies ¡

– ConCnuous-­‑valued ¡phenotypes ¡ – Height, ¡eye ¡color, ¡blood ¡pressure, ¡cholesterol ¡level, ¡body-­‑mass ¡index ¡

• etc. ¡

Con9nuous-­‑Valued ¡Phenotypes ¡

• Clinical ¡data ¡in ¡medicine ¡

– Cholesterol ¡level, ¡body-­‑mass ¡index, ¡and ¡weight ¡ in ¡obesity, ¡diabetes ¡studies ¡ – Blood ¡IgE ¡anCbody ¡level, ¡lung ¡physiology ¡ measurements ¡in ¡asthma ¡studies ¡

• Gene-­‑expression ¡data ¡in ¡biology ¡research ¡

– Microarray ¡data ¡for ¡gene-­‑expression ¡ measurements ¡for ¡tens ¡of ¡thousands ¡of ¡genes ¡ – Can ¡we ¡idenCfy ¡SNPs ¡that ¡influence ¡the ¡gene ¡ expression ¡levels? ¡ – Ofen ¡known ¡as ¡expression ¡quanCtaCve ¡trait ¡ locus ¡(eQTL) ¡mapping ¡

GWAS: ¡Con9nuous-­‑Valued ¡Phenotypes ¡

Genotype ¡Data ¡ N ¡individuals ¡ N ¡individuals ¡ J ¡SNPs ¡ ¡ A ¡conCnuous-­‑valued ¡ phenotype ¡

• ¡Are ¡the ¡SNP ¡and ¡the ¡

phenotype ¡significantly ¡ associated? ¡

• ¡Fit ¡a ¡linear ¡regression ¡model ¡

for ¡each ¡(SNP, ¡phenotype) ¡pair ¡

GWAS: ¡Con9nuous-­‑valued ¡Phenotypes ¡

• ConCnuous-­‑valued ¡traits ¡

– Also ¡called ¡quanCtaCve ¡traits ¡ – Cholesterol ¡level, ¡blood ¡pressure ¡

• etc. ¡
• One ¡cannot ¡create ¡a ¡

conCngency ¡matrix ¡as ¡in ¡case/ control ¡studies ¡

• For ¡each ¡locus, ¡fit ¡a ¡linear ¡

regression ¡using ¡the ¡number ¡of ¡ minor ¡alleles ¡at ¡the ¡given ¡locus ¡

• f ¡the ¡individual ¡as ¡covariate ¡

Linear ¡Regression ¡Model ¡

• Linear ¡regression ¡model ¡is ¡defined ¡as ¡

– Data

• y: ¡a ¡conCnuous-­‑valued ¡phenotype ¡
• x: ¡SNP ¡genotype ¡at ¡a ¡given ¡locus ¡

y = xβ

1 + β0 +ε

Linear ¡Regression ¡Model ¡

• Linear ¡regression ¡model ¡is ¡defined ¡as ¡

– Parameters

• β1: ¡regression ¡coefficient ¡or ¡the ¡parameter ¡that ¡represents ¡the ¡

strength ¡of ¡associaCon ¡between ¡the ¡SNP ¡x ¡and ¡the ¡phenotype ¡y

• β0: ¡intercept ¡term ¡
• ε: ¡noise ¡or ¡the ¡part ¡of ¡y ¡that ¡is ¡not ¡explained ¡by ¡the ¡SNP ¡x ¡(e.g., ¡

environmental ¡effect) ¡

y = xβ

1 + β0 +ε

Linear ¡Regression ¡Model ¡for ¡GWAS ¡

x y β1 : slope ¡ ¡ (associaCon ¡strength) ¡

β0: ¡intercept ¡

ε:noise, ¡ ¡ the ¡part ¡of ¡y ¡that ¡ is ¡not ¡explained ¡ by ¡xβ1+β0 ¡ ¡

Linear ¡Regression ¡Model ¡

• Linear ¡regression ¡model ¡is ¡defined ¡as ¡

– y ¡and ¡x: ¡observed ¡in ¡the ¡dataset ¡ – β1 ¡and ¡β0: ¡parameters ¡to ¡be ¡esCmated ¡from ¡the ¡data ¡

y = xβ

1 + β0 +ε

Lease ¡Square ¡Method ¡for ¡Parameter ¡Es9ma9on ¡

• Popular ¡method ¡for ¡parameter ¡esCmaCon ¡is ¡a ¡least ¡square ¡
• method. ¡

– Given ¡data ¡for ¡N ¡samples ¡(y1, ¡…, ¡yN), ¡(x1, ¡…, ¡xN), ¡solve ¡the ¡following ¡ problem ¡ – By ¡solving ¡this, ¡we ¡find ¡the ¡parameter ¡values ¡that ¡minimize ¡the ¡ squared ¡distance ¡between ¡observed ¡phenotype ¡value ¡(yi’s) ¡and ¡ predicted ¡phenotype ¡value ¡

argmin (yi − xiβ

1 − β0)2 i=1 N

∑

xiβ

1 + β0

Bonferroni ¡Correc9on ¡

• If ¡N ¡markers ¡are ¡tested, ¡we ¡correct ¡the ¡significance ¡level ¡as ¡

α’= ¡α/N ¡

– Assumes ¡the ¡N ¡tests ¡are ¡independent, ¡although ¡this ¡is ¡not ¡true ¡ because ¡of ¡the ¡linkage ¡disequilibrium. ¡ ¡ – Overly ¡conservaCve ¡for ¡Cghtly ¡linked ¡markers ¡

Popula9on ¡Structure ¡and ¡Genome-­‑wide ¡ Associa9on ¡Analysis ¡

• The ¡mutaCon ¡that ¡gives ¡the ¡lactose ¡persistence ¡phenotype ¡is ¡

more ¡common ¡in ¡Caucasian ¡populaCon ¡than ¡in ¡Asian ¡ populaCon ¡

• The ¡allele ¡for ¡blonde ¡hair ¡color ¡is ¡also ¡more ¡common ¡in ¡

Caucasian ¡populaCon ¡than ¡in ¡Asian ¡populaCon ¡

Popula9on ¡Structure ¡and ¡Genome-­‑wide ¡ Associa9on ¡Analysis ¡

• PopulaCon ¡structure ¡in ¡data ¡causes ¡false ¡posiCves ¡in ¡GWAS ¡

– If ¡samples ¡in ¡the ¡case ¡group ¡are ¡more ¡related ¡(come ¡from ¡the ¡same ¡ populaCon ¡group), ¡any ¡SNPs ¡more ¡prevalent ¡in ¡the ¡case ¡populaCon ¡ will ¡be ¡found ¡significantly ¡associated ¡with ¡the ¡trait. ¡

Popula9on ¡Structure ¡and ¡Genome-­‑wide ¡ Associa9on ¡Analysis ¡

• What ¡if ¡we ¡perform ¡GWAS ¡within ¡each ¡populaCon ¡groups. ¡

Half ¡of ¡the ¡ people ¡have ¡ “aa” ¡in ¡both ¡ case ¡and ¡ control ¡groups ¡ Half ¡of ¡the ¡ people ¡have ¡ “AA” ¡in ¡both ¡ case ¡and ¡ control ¡groups ¡

Epistasis ¡

• Epistasis: ¡The ¡effect ¡of ¡one ¡locus ¡depends ¡on ¡the ¡genotype ¡of ¡

another ¡locus ¡

– EpistaCc ¡effects ¡of ¡geneCc ¡loci ¡can ¡be ¡detected ¡only ¡if ¡we ¡consider ¡the ¡ mulCple ¡loci ¡joingly ¡

• In ¡contrast, ¡marginal ¡effects ¡of ¡a ¡locus ¡refers ¡to ¡the ¡geneCc ¡effect ¡of ¡

the ¡locus ¡that ¡is ¡independent ¡of ¡other ¡loci ¡

– Most ¡studies ¡assume ¡the ¡phenotype ¡can ¡be ¡predicted ¡as ¡a ¡sum ¡of ¡single-­‑ locus ¡effects ¡

• Many ¡studies ¡ignore ¡epistasis ¡among ¡mulCple ¡geneCc ¡loci ¡mainly ¡

due ¡to ¡the ¡high ¡computaConal ¡cost ¡for ¡detecCng ¡it, ¡but ¡epistasis ¡is ¡ believed ¡to ¡be ¡prevalent ¡and ¡thus ¡important. ¡

Epistasis ¡for ¡Mendelian ¡Traits ¡

Carlborg ¡& ¡Haley, ¡Nature ¡Reviews ¡GeneCcs ¡2004 ¡

Subnetworks ¡for ¡lung ¡ physiology ¡ Subnetwork ¡for ¡ quality ¡of ¡life ¡

GeneCc ¡AssociaCon ¡for ¡Asthma ¡ Clinical ¡Traits ¡ TCGACGTTTTACTGTACAATT ¡

Tag ¡SNPs ¡and ¡GWAS: ¡Using ¡Reference ¡Datasets ¡ for ¡Genotype ¡Imputa9on ¡

• Reference ¡data: ¡dense ¡SNP ¡

data ¡from ¡HapMap ¡III, ¡or ¡ 1000 ¡genome ¡project ¡

• New ¡data: ¡SNP ¡data ¡for ¡

individuals ¡in ¡a ¡given ¡study ¡

• Data ¡afer ¡imputaCon ¡

Genotype ¡Imputa9on ¡

PHASE ¡can ¡be ¡used ¡for ¡imputaCon! ¡

Tag ¡SNPs ¡and ¡GWAS ¡

(Servin ¡& ¡Stephens, ¡2007) ¡ Tag ¡SNP ¡ Non-­‑tag ¡SNP ¡

Summary ¡

• How ¡to ¡idenCfy ¡disease-­‑related ¡or ¡phenotype-­‑related ¡

genomic ¡loci ¡

– Family-­‑based ¡studies ¡ – PopulaCon-­‑based ¡studies ¡for ¡unrelated ¡individuals ¡

• Genome-­‑wide ¡associaCon ¡study ¡

– Case/control ¡studies ¡for ¡discrete-­‑valued ¡phenotypes ¡

• Chi-­‑square ¡test ¡based ¡on ¡conCngency ¡table ¡created ¡from ¡

genotype/phenotype ¡data ¡ – ConCnuous-­‑valued ¡phenotypes ¡(next ¡lecture) ¡ – Bonferroni ¡correcCons ¡for ¡correcCng ¡for ¡mulCple ¡hypothesis ¡tesCng ¡