Defining the role of CD177 in neutrophil biology Ricardo Grieshaber - PowerPoint PPT Presentation

Defining the role of CD177 in neutrophil biology Ricardo Grieshaber Brigham and Women's Hospital Division of Rheumatology, Immunology and Allergy Medical Student Heidelberg University Peter Nigrovic’s Lab

Agenda • Neutrophils and Ly6G in murine arthritis • CD177 as human homolog • Characterization of CD177 pos /CD177 neg neutrophils 
 → Key neutrophil functions 
 → CyTOF 
 → RNAseq • Outlook: CD177 genetics

Neutrophils are indispensable for K/BxN serum transfer arthritis ( α GR-1) α GR-1 depletes neutrophils … and blocks arthritis Wipke and Allen J Immunol (2001)

Ly6G ligation blocks arthritis in sub-depleting doses n.s. 8 1.00 2 5 0 µ g Clinical arthritis score 7 * * 1 0 0 µ g Number of neutrophils in blood (x 10 -3 / L) 6 5 0 µ g 0.75 C lin ic a l S c o re 5 1 0 µ g 4 5 µ g 0.50 3 P B S 2 0.25 1 0 0.00 Normal PBS Anti-Gr-1 10 g µ (D a y ) -1 0 1 2 3 4 A n ti-G r-1 (a n ti-L y 6 C /G ) o r P B S K /B xN se ru m Wang … Nigrovic Blood (2012)

Is there a human Ly6G? Lee … Nigrovic J Leukoc Biol (2013)

CD177 expression is bimodal 10 5 0 56.4 • Specific to neutrophils • Interacts with PECAM-1 10 4 CD177 • Associates with β 2 integrins 10 3 • Tethers ANCA-autoantigen PR3 
 10 2 to neutrophil surface 43.6 0 0 CD15

Hypothesis independent analysis of neutrophil subsets CD177 CD11b 1. High dimensional analysis 
 → Clustering by CD177 2. Exclusion of CD177 
 → No clustering

Similar expression pattern in CD177 pos and CD177 neg neutrophils BL SF CD177 CD11a CD11b (a) CD11b CD11c Marked differences between 
 CD15 CD16 blood and synovial fluid CD181 CD182 CD183 CD184 No difference in surface protein MFI 
 CD18 (a ) CD18 between CD177 pos and CD177 neg CD273 CD274 CD279 CD32 CD44 CD45 CD59 CD62L CD64 CD66b 0 150 300 HLADR Pos Neg Pos Neg CD177

Functional characterization of CD177

CD177 signals via β 2 integrins to promote migratory arrest attached 800 spreading * % of CD177 pos neutorphils 100 Relative migration (% of unstim ctrl) 600 400 → 50 200 → 0 None Iso α CD177 0 iso α CD177 LTB 4 α CD177 triggers 
 α CD177 
 α CD177 attenuates migration downstream signaling increases spreading Bai … Nigrovic (in preparation)

No difference in key neutrophil functions In vivo migration ROS NETs CD177 neg CD177 pos ns ns 15000 100 8000 MFU SytoxOrange 80 6000 MFI (DCFDA) ns %CD177 pos 10000 60 4000 40 5000 2000 20 0 0 0 PB SF unstim PMA unstim PMA Also tested: Integrin and activation marker expression, cell death

“And a step backward, after making a wrong turn, is a step in the right direction.” ― Kurt Vonnegut (Player Piano)

Pipeline for RNAseq Patient recruitment Synovial fluid + 
 Successful joint tap paired peripheral blood BCH joint tap clinic (Lauren) BWH Rheumatology Attendings Processing FSC/SSC FSC Doublets SSC Doublets Blood: EasySep Isolation Fluid: RBC lysis Staining 
 CD15, CD66b, CD177 Sorting 
 Human Immunology 
 CD66b CD15 Flow Core 
 (Adam, Mike) CD66b CD177

RNAseq on sorted CD177 pos /CD177 neg neutrophils • 6x inflammatory arthritis (paired blood + fluid) • 7x healthy controls (2 donors twice, 5 donors once) • 2x CD177 null (healthy) • 2x unstim/LPS/LTB 4 stimulated neutrophils

Promoting collaborations in the JBC Ricardo Lauren Pui → Low input SmartSeq2 at

Future directions: CD177 genetics

CD177: Striking genotype-phenotype correlation e n e g o d u e s P A T A T A T T T T T T T T T A T A T T T T T A T Wu PLOS Gen (2016)

CD177 and CD177P1 are highly homologous 5 SNPs in complete linkage disequilibrium Lysine CD177 CTTTCCCTCTCACCCTCAGGACTCACATCAACCCTGGTGGGGACAAAAGGCTGCAGCACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CD177P1 CTTTCCCTCTCACCCTCAGGACTCACATCAACCCTGGTGG C GAC CT AA A GCTGCAGC G CT Stop | || | | Variant mapped to human genome build? hg19 � � � � � hg38 � � � � � TT genotype Wu et al. (535 healthy donors, deep sequencing) 2.6 % (in HWE) 1000 Genomes (4x coverage) 10.7 % (not in HWE) → incorrect/missing annotation in genetic databases → poor representation in Illumina MEGA chips (e.g. Partners Biobank)

Genetic linkage of CD177 with RA Harm-Jan Westra, 
 Soumya Raychaudhuri

Acknowledgements BWH Michael B. Brenner Adam Chicoine 
 Peter Nigrovic Michael Gurish 
 Marta Martinez-Bonet 
 Helena Johnnson 
 Margaret Chang 
 Edy Kim 
 Darren Chiu Deepak Rao 
 Pierre Cunin 
 Kevin Wei Olha Halyabar 
 Minah Iqbal Children’s Pui Lee 
 Lauren Henderson, Kacie Hoyt Anaïs Levescot Gang Li 
 MGH Nate Nelson-Maney 
 Roy Soberman, Angela Schmider Yu Yang Former: Ming Bai, Junxia Wang Broad Chad Nusbaum, Jim Bochicchio Soumya Raychaudhuri 
 Harm-Jan Westra 
 Funding Susan Hannes Boehringer Ingelheim Fonds MD Fellowship German Academic Scholarship Foundation Jim Lederer, Anu Seshadri 
 JBC Microgrant

Appendix

α CD177 causes migratory arrest Liu Nat Rev Immunol (2007)

Small Molecule–Mediated Activation of the Integrin CD11b/CD18 
 Reduces Inflammatory Disease increased adhesion reduced in vivo migration → Proof of concept for α CD177-mediated migratory arrest? Maiguel Sci Signal (2011)