Defining the role of CD177 in neutrophil biology Ricardo Grieshaber - - PowerPoint PPT Presentation
Defining the role of CD177 in neutrophil biology Ricardo Grieshaber - - PowerPoint PPT Presentation
Defining the role of CD177 in neutrophil biology Ricardo Grieshaber Brigham and Women's Hospital Division of Rheumatology, Immunology and Allergy Medical Student Heidelberg University Peter Nigrovics Lab Agenda Neutrophils and Ly6G in
Agenda
- Neutrophils and Ly6G in murine arthritis
- CD177 as human homolog
- Characterization of CD177pos/CD177neg neutrophils
→ Key neutrophil functions → CyTOF → RNAseq
- Outlook: CD177 genetics
Neutrophils are indispensable for K/BxN serum transfer arthritis
Wipke and Allen J Immunol (2001)
αGR-1 depletes neutrophils … and blocks arthritis
(αGR-1)
Ly6G ligation blocks arthritis in sub-depleting doses
Wang … Nigrovic Blood (2012)
- 1
1 2 3 4 1 2 3 4 5 6 7 8 2 5 0 µg 1 0 0 µg 5 0 µg 1 0 µg 5 µg P B S A n ti-G r-1 (a n ti-L y 6 C /G ) o r P B S K /B xN se ru m (D a y ) C lin ic a l S c o re
Normal PBS Anti-Gr-1 10 g 0.00 0.25 0.50 0.75 1.00
* *
n.s. Number of neutrophils in blood (x 10-3/ L) µ
Clinical arthritis score
Is there a human Ly6G?
Lee … Nigrovic J Leukoc Biol (2013)
CD177 expression is bimodal
- Specific to neutrophils
- Interacts with PECAM-1
- Associates with β2 integrins
- Tethers ANCA-autoantigen PR3
to neutrophil surface
102 103 104 105 0
56.4 43.6
CD15 CD177
Hypothesis independent analysis of neutrophil subsets
- 1. High dimensional analysis
→ Clustering by CD177
- 2. Exclusion of CD177
→ No clustering
CD11b CD177
Similar expression pattern in CD177pos and CD177neg neutrophils
BL SF
Pos Neg Pos Neg
CD177 CD11a CD11b (a) CD11b CD11c CD15 CD16 CD181 CD182 CD183 CD184 CD18 (a ) CD18 CD273 CD274 CD279 CD32 CD44 CD45 CD59 CD62L CD64 CD66b HLADR 150 300
CD177
Marked differences between blood and synovial fluid No difference in surface protein MFI between CD177pos and CD177neg
Functional characterization of CD177
CD177 signals via β2 integrins to promote migratory arrest
Bai … Nigrovic (in preparation)
αCD177 triggers downstream signaling
None Iso αCD177 200 400 600 800 Relative migration (% of unstim ctrl) LTB4 *
αCD177 attenuates migration αCD177 increases spreading → →
iso αCD177 50 100 % of CD177pos neutorphils attached spreading
No difference in key neutrophil functions
unstim PMA 5000 10000 15000 MFU SytoxOrange
ns ns
CD177neg CD177pos
unstim PMA 2000 4000 6000 8000 MFI (DCFDA) ns
In vivo migration ROS NETs Also tested: Integrin and activation marker expression, cell death
PB SF 20 40 60 80 100 %CD177pos
“And a step backward, after making a wrong turn, is a step in the right direction.” ― Kurt Vonnegut (Player Piano)
Pipeline for RNAseq
Patient recruitment BCH joint tap clinic (Lauren) BWH Rheumatology Attendings Successful joint tap Synovial fluid + paired peripheral blood Processing Blood: EasySep Isolation Fluid: RBC lysis Staining CD15, CD66b, CD177 Sorting Human Immunology Flow Core (Adam, Mike)
CD177 CD66b CD66b CD15 FSC/SSC FSC Doublets SSC Doublets
RNAseq on sorted CD177pos/CD177neg neutrophils
- 6x inflammatory arthritis (paired blood + fluid)
- 7x healthy controls (2 donors twice, 5 donors once)
- 2x CD177null (healthy)
- 2x unstim/LPS/LTB4 stimulated neutrophils
Promoting collaborations in the JBC
Ricardo Pui Lauren
→ Low input SmartSeq2 at
Future directions: CD177 genetics
CD177: Striking genotype-phenotype correlation
Wu PLOS Gen (2016)
A T A T A T T T T T T T A T A T A T T T T T T T P s e u d
- g
e n e
CD177 and CD177P1 are highly homologous
CD177 CTTTCCCTCTCACCCTCAGGACTCACATCAACCCTGGTGGGGACAAAAGGCTGCAGCACT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CD177P1 CTTTCCCTCTCACCCTCAGGACTCACATCAACCCTGGTGGCGACCTAAAGCTGCAGCGCT | || | |
5 SNPs in complete linkage disequilibrium Variant mapped to human genome build? hg19 hg38
- Lysine
Stop