BIOMARKERS IN CHRONIC LYMPHOCYTIC LEUKEMIA: THE ART OF SYNTHESIS - PowerPoint PPT Presentation

INTERNATIONAL WORKSHOP BIOMARKERS IN CHRONIC LYMPHOCYTIC LEUKEMIA: THE ART OF SYNTHESIS Session IV. Immunogenetics Interactive case session Frederic Davi Professor | Hôpital Pitié - Salpêtrière Andreas Agathangelidis post-doc | Institute of Applied Biosciences (INAB) Belgrade | March 16-17, 2018

Background Germline V D J D-J joining V D J germline V rearranged V D J V-DJ joining SHM status CDR3 How? Belgrade | March 16-17, 2018

VH CDR3 104 118 C W V N 1 D N 2 J tgtgcaaaag gacc gactacggtggtaactcc gggg tttgactactgg C A K G P T T V V T P G F D Y W tgt gca aaa gga ccg act acg gtg gta act ccg ggg ttt gac tac tgg

SHM analysis – clinical relevance 98% cut-off Hamblin et al., Blood 1999 Damle et al., Blood 1999 Survival was significantly worse for patients Patients in the unmutated group responded with unmutated VH genes irrespective of poorly to chemotherapy stage. and had shorter survival.

CLL: not only M and UM cases? Borderline cases: • not intermediate prognosis • mix of cases with aggressive and indolent disease

Aim • An Introduction of IMGT/V-QUEST tool - get familiar with the sequence submission process - review basic parameters of the tool • Interactive exercises - analysis of IGH rearrangement sequences - sequence annotation and feature characterization • Sequence interpretation and results Belgrade | March 16-17, 2018

IMGT/V-QUEST Access: http://www.imgt.org/ Belgrade | March 16-17, 2018

Sequence submission Submit a single or a manual copy/paste or In FASTA format : : batch of sequences (up file upload to 50) Belgrade | March 16-17, 2018

Results retrieval Information about the type of output files provided in each case: IMGT/V-QUEST Documentation http://www.imgt.org/IMGT_vquest/share/textes/imgtvquest.html Belgrade | March 16-17, 2018

>Sequence A1 caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctc acctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagccccca gggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaaccc gtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctaaag ctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagaggtctacctcttttgg agtggttattgggtccttactactactactacggtatggacgtctggggccaagggaccacgg tcaccgtctcct Belgrade | March 16-17, 2018

Sequence A1

Sequence A1 Belgrade | March 16-17, 2018

Results IGHV4-34*01 IGHD3-3*01 IGHJ6*02 identity 99,65% Prognosis? in-frame VH CDR3 length 22 aa → p roductive, unmutated IGH Belgrade | March 16-17, 2018

>Sequence A2 caggtgcagctggtgcagtctggagctgaagtgaagaagcctggggcctcagtgaaggtc tcctgcaaggcttctggttacacctttacgaattatggtatcggctgggtgcgacaggcccctg gacaagggcttgagtggatgggatggatcagcggttacaatggtgatacaaactatgcaca gaagttccaggacagagtcaccatgaccacagacacatccacgagcacagcctatatgg acctggggagcctgagatctgacgacacggccgtgtattactgtgcgagagtagtggctac gctcccccccgtctactggggccagggaaccctggtcaccgtctcctca Belgrade | March 16-17, 2018

Sequence A2 Belgrade | March 16-17, 2018

Sequence A2 Belgrade | March 16-17, 2018

Sequence A2 IGHV1-18*01 IGHD5-12*01 IGHJ4*02 identity 95,14% Prognosis? in-frame VH CDR3 length 11 aa → p roductive, mutated IGH Belgrade | March 16-17, 2018

>Sequence A3 gaggtgcagctggtggagtctgggggaggcttggtccagcctggagggtccctgagactct cctgtgcagcctctggattcaccttcagtgaccactacatggactgggtccgccgggctcca gggaaggggctggagtgggttggccgtactagaaataaagctaacagttacaccacaga gtacgccgcgtctgtgaaaggcagattcaccatctcaagagatgattcaaacaactcactgt atctacaaatgagcagcctgaaaatcgaggacacggccgtgtattactgtgttcgagtctttat acctacctccacacccgactactggggccagggaaccctggtc

Sequence A3

Sequence A3 IGHV3-72*01 IGHD3-16*02 IGHJ4*02 identity 97,62% Prognosis? in-frame VH CDR3 length 12 aa → p roductive, borderline mutated IGH

Ghia P et al. ERIC recommendations on IGHV gene mutational status analysis in CLL. Leukemia 2007;21: 1-3 as for any mathematical cutoff value applied to a biological phenomenon, one has to be cautious when dealing with ‘ borderline cases ’

>Sequence A4 gaggtgcagttggtggagtctgggggaggcctggtcaagcctggggggtccctgagac tctcctgtgcagcctctggattcaccttcagtagctatagcatgaactgggtccgccaggct ccagggaaggggctggagtgggtctcatccattactattagtagtggttacatatactacg cagactcagtgaggggccgattctccctctccagagacaacgccaagaactcactgtat ctgcaaatgaacagcctgcgagccgaagacacggctgtgtattactgtgcgagagatg ccaacggtatggacgtctgggggcaaggg

Sequence A4

Sequence A4 IGHV3-21 • Mostly IGHJ6 • VH CDR3 : 9 aa • D or E at position VH • CDR3-107 This rearrangement represents a CLL subset #2 case.

Sequence A4 IGHV3-21*01 IGHD3-16*02 IGHJ6*01 identity 96,88% Prognosis? in-frame VH CDR3 length 9 aa → p roductive, mutated IGH, subset #2 case

>Sequence A5 gagatgcagctggtggagtctgggggaggcctggtcaaccctggggagtccctgagactct cctgtgcatcctctggattcaccctcagtagctatagtatgagctgggtccgccaggctccag ggaaggggctggagtgggtctcatcccttagtagtagtagtggttacgtatactacgcagact cagtgaagggccgattcaccatctccagagacaacgccatgaactcactgtatctgcaaat gaacagcctgagagccgaggacacggctgtgtattactgtgcgagagatgccaacggtat ggacgtctgggggcaagga

Sequence A5 IGHV3-21*01 IGHD2-2*01 IGHJ6*02 Prognosis? identity 96,18% in-frame → p roductive, mutated IGH Belgrade | March 16-17, 2018

Sequence A5 Patients belonging to subset #2 have poor prognosis irrespective of SHM status and this should be stated clearly in the report to the clinician.

>Sequence B2 gaggtgcacctggtggagtctgggggaggcctggtcaacccgggggggtccctcagactc tcctgtgcagcctctggattcaccttcagtaattttagcatgacctgggtccgccaggctccag ggcaggggctggagtgggtctcatccatggagtgggtctcatccattagtagtagtagtaatt acatatactacgcagactcagtgaagggccgattcaccatctccagagacaacgccaag aactcactgtatctgcaattgaacagcctgagaggcgaggacacggctgtttattactgtgcg agaatggtggcttccaagtacccaccatactactttgacttctggggcccgggaaccctggtc accgtctcctcag Belgrade | March 16-17, 2018

Sequence B2 Belgrade | March 16-17, 2018

Sequence B1 IMGT/V-QUEST provides warnings to alert the users, for the possibility that potential insertions or deletions are present in the sequence http://www.imgt.org/IMGT_vquest/share/textes/IMGTvquest-warnings.pdf Warning Objective V ‐ GENE and allele: low V ‐ REGION identity less than 85% of identity with the closest germline V ‐ GENE and allele: percentage with the closest this may indicate that the V ‐ GENE and allele name could be not reliable. V germline V ‐ GENE and allele: the sequence junction may not de reliable. 2nd ‐ CYS 104 not identified V ‐ GENE and allele: different CDR1 ‐ IMGT and/or CDR2 ‐ IMGT amino this may indicate that the V gene and allele name could be not reliable. acid lengths compared to closest V germline Belgrade | March 16-17, 2018

Sequence B1 Back to the submission form • Enable the option at the “advanced parameters” tab • • Note that now you can simultaneously analyze a batch of max. 10 sequences Belgrade | March 16-17, 2018

Sequence B2 not causing frameshift  Potentially productive IGH rearranged sequence 18nt insertion detected in VH FR2 region % identity to germline is calculated considering the insertion as one mutational event Belgrade | March 16-17, 2018

Sequence B2 IGHV3-21*01 IGHD5-12*01 IGHJ4*02 identity 95.14% Prognosis? in-frame VH CDR3 length 15 → productive, mutated IGH rearrangement Belgrade | March 16-17, 2018