06.05.2017| Rolf Kaiser HBV 3TC, ADF, TDF, replication- ETV (LdT) - PowerPoint PPT Presentation

06.05.2017| Rolf Kaiser

HBV 3TC, ADF, TDF, replication- ETV (LdT) cycle and antiviral targets 06.05.2017| Rolf Kaiser Gerlich and Kann in Topley & Wilson

0.25 Product 1 (base 377 to 864) For: 5’ GGATGTGTCTGCGGCGTTT3’ Rev: 5’ ACCCCATCTTTTTGTTTTGTTAGG3’ Product 2 (base 252 to 819) For: 5’ AGACTCGTGGTGGACTTCTCT3’ Rev: 5’ CAAAAGAAAATTGGTAACAGCGGTA3’ Allen et al., 1998 N236T 0.87 06.05.2017| Rolf Kaiser

Terminal Protein L180M+ M204V+ TDF A181V? 198? N236T? Angus, Gastroenterology 2003; Delaney ,J Virol 2003; Allen, Hepatology 1998; Colonno, Hepatology 2004 06.05.2017| Rolf Kaiser

HBV Genotypes 06.05.2017| Rolf Kaiser Schaefer, J Viral Hep 2005

HBV-Genotype distribution Düsseldorf E G B C 3,5 2 7 47 A 40 D N = 165 [ % ] Erhardt, Gut , 2005 Jul;54(7):1009-13. 06.05.2017| Rolf Kaiser

D Köln data B E A G 06.05.2017| Rolf Kaiser

HIV-GRADE Output M. Obermeier 06.05.2017| Rolf Kaiser Medizinisches Labor Berg

HIV-GRADE Output 06.05.2017| Rolf Kaiser

How to find the Tool: http://www.genafor.org geno2pheno[hbv] 06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

geno2pheno[hbv] – Sequence Information (Sub)Genotype Completeness and Similarity Mutations Escape Mutations 06.05.2017| Rolf Kaiser

HBV HBsAg Major hydrophilic loop Mutationen reported with escape Jens Verheyen, Maria Fraune G N S M Q 105L 130D/R Carman, et al. 1990 109R/V/H/I *131D/I/S F A *110M/R/H/I/V 132A/P Oon et al. 1994 *114R P 133I/L/T/V P 117T *134H/N/R/S/V S 118K/R/S/P 137R/S/W/Y T P 119R K 139S T C T 120A/E/LP/Q/S/T/R 140S T D 121S/Y C 141E/I/R C 123A/N 142L/R/S C T G G145R 124R/Y *143L/P *126N/S/V/I/T N K 144A/E/G *127R/S/T 145A/K/L/R P C C C 128V 146D/S P T V 129H/K/P/R G 147S/T C L T *Positionen an denen P I genotyp-spezifische S I P L Polymorphismen vorkommen T P M I Prevalence: T G T G A S S W S F G145R: 0,4% Q A D144A: 0,7% Y K D144G: 0,4% D Y M133I: 1,8% L C124R: 0,4% L 98- W -163 C124Y: 0,7% T123N: 0,4% HBV-Hülle Schaefer et al., 2004 ........ _____________ 06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

Recombinant Escape Mutants Jens Verheyen, Maria Fraune Axsym Centaur Architect BEP III Vidas Assay A Assay B Assay C Assay D Assay E Abbott Siemens Abbott Siemens bioMerieux wt-genotype D 100,0% 100,0% 100,0% 100,0% 100,0% P120T 50,0% 7,0% 100,0% 120,0% 140,0% C121Y 3,0% < 1% 5,0% 50,0% 26,0% R122I 24,0% 43,0% 92,0% 120,0% 120,0% T123N 2,7% < 1% 2,0% 110,0% 30,0% C124R 3,1% < 1% 7,0% 40,0% 17,0% T125M 76,0% 83,0% 120,0% 110,0% 130,0% T126I 74,0% 70,0% 120,0% 100,0% 120,0% T126V 64,0% 80,0% 100,0% 110,0% 110,0% G130D 100,0% 56,0% 110,0% 100,0% 110,0% P142S 58,8% < 1% 110,0% 110,0% 150,0% G145R 110,0% < 1% 86,0% 110,0% 110,0% 06.05.2017| Rolf Kaiser

For Mailing and Archiving geno2pheno[hbv] – PDF Output Sequence Information Drug Resistance Place your own comments 06.05.2017| Rolf Kaiser

Thanks to our group University of Düsseldorf I nstitute of Virology, University of Cologne Hepatology & I nfectiology Rolf Kaiser Björn Jensen, Ulrike Haars, Falk Hüttig Elena Knops Verena Keitel, Dieter Häussinger Veronica Di Cristanziano Maria Neumann-Fraune I nstitute of Virology Eugen Schülter Nadine Lübke, Andreas Walker, Jörg Timm Claudia Müller Dörte Hammerschmidt EURESI ST Ramona Gilles Saleta Sierra-Aragon Francesca Incardona, Informa, Rome Eva Heger Maurizio Zazzi, Andrea De Luca, Uni Siena Baki Akgül Anders Sönnerborg, Karolinska, Stockholm Herbert Pfister Thomas Lengauer, MPI Saarbrücken Rolf Kaiser, Uni Koeln Institute for Immunogenetics, Kaiserslautern Martin Däumer, Alex Thielen MPI for Informatics, Saarbrücken Thomas Lengauer, Nico Pfeifer, Matthias Döring, Alejandro Pironti, Prabhav Kalaghatgi , MASTER –HIV/HEP (RKI, Resina) Norbert Bannert, Barbara Bartmeyer, Osama Hamouda, Klaus Jansen, Claudia Kücherer, Andrea Hauser; Robert Koch Institut (RKI), Berlin Mark Oette, Dept. Gastroenterologie, Krankenhaus der Augustinerinnen, Cologne Nazifa Quirishi, Katja Römer, Praxis Gotenring, Cologne Stephan Scholten, Praxis Hohenstaufenring, Cologne Stefan Esser, Dermatology, University Clinics Essen Martin Obermeier, Hauke Walter, Thomas Berg, mib, Berlin Patrick Braun, Heribert Knechten, PZB Aachen Funding by MASTER-HIV/HEP –BMG / DZIF-TTU-Hepatitis BMBF 06.05.2017| Rolf Kaiser 18

Summary Geno2pheno[HBV] analyses the Polymerase (RT), Pre Core, sAntigen region of the HBV-genome. Geno2pheno[HBV] predicts drug resistance of 3TC, ETV, TDF Geno2pheno[HBV] analyses the HBV genotype Geno2pheno[HBV] analyses the HBV escape mutants The escape mutations dataset comprises 67 mutations at 28 distinct amino acid positions. geno2pheno [hbv] is capable of detecting cases of dual infection with strains of distinct genotypes. Interpretation is synchronised with HIV-GRADE[HBV] Geno2pheno[HBV] will be prepared to analyse drug resistnace to the new drugs 06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser

06.05.2017| Rolf Kaiser