WHO WHY HOW ? GOAL to share the love that we are receiving from - PowerPoint PPT Presentation

Mar 23, 2023 •546 likes •788 views

WHO WHY HOW ? GOAL to share the love that we are receiving from our Lord. Make friends, be brothers and sisters with people which we meet in Asylcenters and wherever we go. to make this world a better place! Together we can make a

WHO WHY HOW ?
GOAL to share the love that we are receiving from our Lord. Make friends, be brothers and sisters with people which we meet in Asylcenters and wherever we go. to make this world a better place! Together we can make a difference!
STRUCTURE Monthly activities Fully financed by the project with financial resources made available by Caritas
2015 LANGÅ
2015 - 2016 Voldby
JANUARY
FEBRUARY
MARCH
NEWROZ
Spontaneous visit after we learnt that the centre would be closed any time and with short notice
Another quick visit the in the beginning of October to ease the feeling of uncertainty about the future
October - Ree park
Here I am! I stand at the door and knock. If anyone hears my voice and opens the door, I will come in and eat with that person, and they with me. Revelation 3:20

Download Presentation

Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Flex Ray: Coding and Decoding, Media Access Control, Frame and Symbol Processing Seminar: The

Flex Ray: Coding and Decoding, Media Access Control, Frame and Symbol Processing Seminar: The FlexRay Communication Protocol Chair of Prof. Dr. W. J. Paul Talk by Michael Gerke 27-9-2005 Overview Media access Frame and control (MAC)

1.01k views • 64 slides

Type-Logical Grammar and Natural Language Syntax Yusuke Kubota University of Tsukuba

Type-Logical Grammar and Natural Language Syntax Yusuke Kubota University of Tsukuba kubota.yusuke.fn@u.tsukuba.ac.jp LACompLing 2018 Yusuke Kubota Type-Logical Grammar and Natural Language Syntax 1 /44 Outline Overview of Hybrid

952 views • 82 slides

*........... it would separate some vertices of G inside the cycle from vertices outside (and this

Three applications Chapter 11 of Euler's formula .4 graph isplonar if it can be drawn in the plane W2 without crossing edges (or. equivalently, on the 2-dimensional sphere S2). We talk of aplane graph if such a drawing is already given and fixed.

189 views • 6 slides

Measurement Results of a Large Dynamic Range CSA - UMC 180 nm Process - P. Wieczorek, H.

Outline Architecture and Properties Mode of Operation Measured Results Summary and Outlook Measurement Results of a Large Dynamic Range CSA - UMC 180 nm Process - P. Wieczorek, H. Flemming and H. Deppe GSI Helmholtzzentrum fuer

345 views • 21 slides

Update on Therapies for Idiopathic Pulmonary Fibrosis Paul Wolters Associate Professor University

6/2/2015 Update on Therapies for Idiopathic Pulmonary Fibrosis Paul Wolters Associate Professor University of California, San Francisco Outline Classification of Interstitial lung disease Clinical classification Importance of

648 views • 29 slides

10-601 Machine Learning HMM applica)ons in computa)onal biology Central

10-601 Machine Learning HMM applica)ons in computa)onal biology Central dogma CCTGAGCCAACTATTGATGAA DNA transcription mRNA CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data

869 views • 45 slides

Financial Disclosures Vertebral body stapling in children with idiopathic Theologis: none

5/11/2013 Financial Disclosures Vertebral body stapling in children with idiopathic Theologis: none scoliosis < 10 years of age with curve magnitude Cahill: DePuy Synthes Spine 30-39 degrees Auriemma: none Alexander A. Theologis,

358 views • 6 slides

Challenges for Socially-Beneficial AI Daniel S. Weld University of Washington Outline

Challenges for Socially-Beneficial AI Daniel S. Weld University of Washington Outline Distractions vs. Important Concerns Sorcerers Apprentice Scenario Specifying Constraints & Utilities Explainable AI Data Risks

748 views • 72 slides

Beneficial AI Daniel S. Weld 1 Outline Distractions Important Concerns Unemployment

Beneficial AI Daniel S. Weld 1 Outline Distractions Important Concerns Unemployment Sorcerers Apprentice Scenario Specifying Constraints & Utilities Explainable AI Deployment Its the Data, Stupid 3 1 Please

461 views • 21 slides

The Wizardry of Scaling Ayende Rahien / Oren Eini http://ayende.com/Blog ayende@ayende.com

The Wizardry of Scaling Ayende Rahien / Oren Eini http://ayende.com/Blog ayende@ayende.com Scaling A service is said to be scalable if when we increase the resources in a system, it results in increased performance in a manner proportional

883 views • 33 slides

On Our Best Behaviour Hector J. Levesque Dept. of Computer Science University of Toronto RE

. . On Our Best Behaviour Hector J. Levesque Dept. of Computer Science University of Toronto RE Lecture 1 / 30 . . Thanks to my coauthors! Fahiem Bacchus Vaishak Belle Ron Brachman Phil Cohen Ernie Davis Jim Delgrande Giuseppe de

428 views • 14 slides

storage & search up in the clouds History of Information April 10, 2012 Tuesday, April 10,

storage & search up in the clouds History of Information April 10, 2012 Tuesday, April 10, 2012 aob http://www.npr.org/series/149920095/starting-up-silicon-valleys-origins 24-HofI12_Storage&Search-PD 3 Tuesday, April 10, 2012

755 views • 56 slides

Parallelism From The Middle Out (Adapted from PLDI 2012) Doug Lea SUNY Oswego The Middle Path

Parallelism From The Middle Out (Adapted from PLDI 2012) Doug Lea SUNY Oswego The Middle Path to Parallel Programming Bottom up: Make computers faster via parallelism Instruction-level, multicore, GPU, hw-transactions, etc Initially rely on

506 views • 29 slides

Spatial and Temporal Knowledge Representation Antony Galton University of Exeter, UK PART I:

Third Indian School on Logic and its Applications 18-29 January 2010 University of Hyderabad Spatial and Temporal Knowledge Representation Antony Galton University of Exeter, UK PART I: What is Knowledge Representation? Antony Galton

429 views • 26 slides

ASTR633 Astrophysical Techniques Jonathan Williams jw@hawaii.edu C-209

ASTR633 Astrophysical Techniques Jonathan Williams jw@hawaii.edu C-209 http://www.ifa.hawaii.edu/users/jpw/classes/techniques/ Who am I? - born in England a long time ago - 1988 BA mathematics @ Cambridge - 1995 PhD astronomy @ Berkeley

190 views • 17 slides

Ignoring the threat of white nationalism didnt work. The New York Times Magazines November

Ignoring the threat of white nationalism didnt work. The New York Times Magazines November 3, 2018 cover story detailed the mix of indifference, apathy, and ignorance that allowed the threat of white nationalism to grow. In 2018,

171 views • 16 slides

Best Practices for Getting a PPP Loan Speakers Dan Martini , VP Congressional Relations &

Best Practices for Getting a PPP Loan Speakers Dan Martini , VP Congressional Relations & Political Affairs Dafina Williams , Senior Vice President, Public Policy Opportunity Finance Network Jeffrey Tews , Franchisee, Brightstar Care John

268 views • 16 slides

"what is the will of the gods?" continuous discrete (closed set) yes or no? how many?

cleromancy Allison Parrish "what is the will of the gods?" continuous discrete (closed set) yes or no? how many? magic 8 ball It is certain. As I see it, yes. Reply hazy, try again. Don't count on it.

255 views • 22 slides

Cops and Robbers on Intersection Graphs ciak , V t Jel nek, Pavel Klav k, Jan

Cops and Robbers on Intersection Graphs ciak , V t Jel nek, Pavel Klav k, Jan Kratochv l Tom a s Gaven Department of Applied Mathematics, Charles University, Prague Computer Science Institute, Charles University,

672 views • 35 slides

The Dynamical Structure and Ini3al Mass Func3on of the Arches Cluster Jessica Lu (UH/IfA), Jay

The Dynamical Structure and Ini3al Mass Func3on of the Arches Cluster Jessica Lu (UH/IfA), Jay Anderson (StSci), Ma;hew Hosek Jr. Andrea Ghez (UCLA), Mark Morris (UCLA), Will Clarkson (UMichigan-Dearborn), Tuan Do Graduate Student, UH/IfA

286 views • 24 slides

ReCon: Revealing and Controlling PII Leaks in Mobile Network Systems Jingjing Ren, Martina

ReCon: Revealing and Controlling PII Leaks in Mobile Network Systems Jingjing Ren, Martina Lindorfer, Ashwin Rao, Arnaud Legout, David Choffnes (MobiSys 16) Presented by : Umar Farooq CS 563 Fall 2018 Mobile Phones today.. q Offer

439 views • 27 slides

SAWC FORUM It is the unit within which the most important decisions to manage uncertain

Focus on the Household! SAWC FORUM It is the unit within which the most important decisions to manage uncertain events are made It is the unit that benefits the positive effects of policies and suffers for negative effects of shocks

318 views • 3 slides

PIT Overload Analysis in Content Centric Networks Matteo Virgilio, Guido Marchetto, Riccardo

ACM SIGCOMM Workshop on Information-Centric Networking 12/08/2013 PIT Overload Analysis in Content Centric Networks Matteo Virgilio, Guido Marchetto, Riccardo Sisto Department of Control and Computer Engineering Politecnico di Torino 1/16

393 views • 16 slides

NoMoAds: Effective and Efficient Cross-App Mobile Ad-Blocking Anastasia Shuba Athina

NoMoAds: Effective and Efficient Cross-App Mobile Ad-Blocking Anastasia Shuba Athina Markopoulou Zubair Shafiq UC Irvine UC Irvine University of Iowa Motivation Issues with Mobile Ads: 1. Intrusive 2. Overhead 3. Tracking 4. Malware

859 views • 27 slides