segment based multiple sequence alignment
play

Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, - PowerPoint PPT Presentation

Mar 07, 2024 •13 likes •423 views

Knut Reinert May 2009 Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, D. Weese, A. Dring, C. Notredame and K. Reinert Knut Reinert 25.5.2009 (based on slides from Tobias Rausch) Algorithmische Bioinformatik Monday, May

  1. Knut Reinert May 2009 Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, D. Weese, A. Döring, C. Notredame and K. Reinert Knut Reinert 25.5.2009 (based on slides from Tobias Rausch) Algorithmische Bioinformatik Monday, May 25,

  2. Tobias Rausch, Agenda September 2008 • Alignment Graph • Multiple Sequence Alignment Algorithm • Implementation and Results Algorithmische Bioinformatik Monday, May 25,

  3. Tobias Rausch, Segment-based Alignment Graph September 2008 • Alignment Matrix • Alignment Graph Algorithmische Bioinformatik Monday, May 25,

  4. Tobias Rausch, Applications September 2008 • Protein Alignment Algorithmische Bioinformatik Monday, May 25,

  5. Tobias Rausch, Applications September 2008 • Protein Alignment • Genome Comparison Algorithmische Bioinformatik Monday, May 25,

  6. Tobias Rausch, Applications September 2008 • Protein Alignment • Genome Comparison • Multi-Read Alignment Algorithmische Bioinformatik Monday, May 25,

  7. Tobias Rausch, Methods September 2008 Alignment Algorithm Algorithmische Bioinformatik Monday, May 25,

  8. Tobias Rausch, Components of the Algorithm September 2008 Algorithmische Bioinformatik Monday, May 25,

  9. Tobias Rausch, Components of the Algorithm September 2008 Algorithmische Bioinformatik Monday, May 25,

  10. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] Algorithmische Bioinformatik Monday, May 25,

  11. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] Algorithmische Bioinformatik Monday, May 25,

  12. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants: Overlap, Banded Algorithmische Bioinformatik Monday, May 25,

  13. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] S 0 :XMJYAUZ S 1 :MZJAWXUE Algorithmische Bioinformatik Monday, May 25,

  14. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] S 0 :XMJYAUZ S 1 :MZJAWXUE Algorithmische Bioinformatik Monday, May 25,

  15. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] – External segment-matches • MUMmer, BLAST hits • External alignments Algorithmische Bioinformatik Monday, May 25,

  16. Tobias Rausch, Collect all Segment Matches September 2008 IPPQFDFRDEYPQC--VKP IPEYVD----WRQKGAVTP VKP IPPQFD VTP IPEYVD YPQC WRQK Algorithmische Bioinformatik Monday, May 25,

  17. Tobias Rausch, Segment Match Refinement September 2008 Algorithmische Bioinformatik Monday, May 25,

  18. Tobias Rausch, Segment Match Refinement September 2008 Algorithmische Bioinformatik Monday, May 25,

  19. Tobias Rausch, Segment Match Refinement September 2008 [HHR02, REW+08] Algorithmische Bioinformatik Monday, May 25,

  20. Tobias Rausch, Alignment Graph Construction September 2008 Algorithmische Bioinformatik Monday, May 25,

  21. Tobias Rausch, Alignment Graph Construction September 2008 • Only a subset of all the edges constitutes a valid alignment Algorithmische Bioinformatik Monday, May 25,

  22. Tobias Rausch, Alignment Graph Construction September 2008 • Only a subset of all the edges constitutes a valid alignment • Select the alignment edges (trace edges) of maximum weight = Maximal Trace [SK83,Kec93] Algorithmische Bioinformatik Monday, May 25,

  23. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA-TCAT GARFIELDTHE----FASTCAT --------THE----FA-TCAT [NHH00] Algorithmische Bioinformatik Monday, May 25,

  24. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFATCAT GARFIELDTHEFAS---TCAT --------THEFA----TCAT Algorithmische Bioinformatik Monday, May 25,

  25. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFATCAT GARFIELDTHE FAS---TCAT --------THE FA----TCAT Algorithmische Bioinformatik Monday, May 25,

  26. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA TCAT GARFIELDTHEFAS--- TCAT --------THEFA---- TCAT Algorithmische Bioinformatik Monday, May 25,

  27. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFA TCAT GARFIELDTHE FAS--- TCAT --------THE FA---- TCAT Algorithmische Bioinformatik Monday, May 25,

  28. Tobias Rausch, Consistency Extension September 2008 • Increase the weight of clique edges [NHH00] Algorithmische Bioinformatik Monday, May 25,

  29. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA-TCAT GARFIELDTHE----FASTCAT --------THE----FA-TCAT Algorithmische Bioinformatik Monday, May 25,

  30. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFA- TCAT GARFIELDTHE ----FAS TCAT --------THE ----FA- TCAT Algorithmische Bioinformatik Monday, May 25,

  31. Tobias Rausch, Distance Matrix September 2008 Algorithmische Bioinformatik Monday, May 25,

  32. Tobias Rausch, Guide Tree September 2008 Algorithmische Bioinformatik Monday, May 25,

  33. Tobias Rausch, Graph-based Progressive Alignment September 2008 • Progressive alignment – Aligns strings / profiles of vertices – Heaviest common subsequence algorithm [JV92] Algorithmische Bioinformatik Monday, May 25,

  34. Tobias Rausch, Graph-based Progressive Alignment September 2008 Algorithmische Bioinformatik Monday, May 25,

  35. Tobias Rausch, Configurable September 2008 Algorithmische Bioinformatik Monday, May 25,

  36. Tobias Rausch, Implementation and Results September 2008 Implementation and Results Algorithmische Bioinformatik Monday, May 25,

  37. Tobias Rausch, Results September 2008 Deep Alignment Protein Alignment DNA and Multi-Read Genome Alignment Alignment Algorithmische Bioinformatik Monday, May 25,

  38. Tobias Rausch, Results September 2008 • BAliBASE 3.0 (Protein Benchmark) RV11 RV12 RV20 RV30 RV40 RV50 CPU time (s) M-Coffee 42.74 85.86 44.78 56.1 55.8 54.69 27,730 Our Tool 46.89 86.16 46.56 58.9 62.39 58.94 12,455 • Alignment of 6 adenoviruses (DNA) Avg. Identity CPU time (s) DIALIGN-T 48% 1259 MAFFT 62% 118 MUSCLE 38% 673 Our Tool 65% 328 • More detailed results are in the paper Algorithmische Bioinformatik Monday, May 25,

  39. Tobias Rausch, Part of SeqAn September 2008 • Extendable – Add your own algorithm www.seqan.de Algorithmische Bioinformatik Monday, May 25,

  40. Tobias Rausch, Thank You for Your Attention! September 2008 Visit: www.seqan.de/projects/msa.html Andreas Anne-Katrin Cedric David Knut Tobias Algorithmische Bioinformatik Monday, May 25,

  41. Tobias Rausch, References September 2008 [Got82] O. Gotoh. An improved algorithm for matching biological sequences. J. Mol. Biol., 162(3): 705–708, Dec 1982. [HHR02] A. L. Halpern, D. H. Huson, and K. Reinert. Segment match refinement and applications. In WABI ’02: Proceedings of the Second International Workshop on Algorithms in Bioinformatics, pages 126–139, London, UK, 2002. Springer-Verlag. [JV92] G. Jacobson and K.-P . Vo. Heaviest increasing/common subsequence problems. In CPM ’92: Proceedings of the Third Annual Symposium on Combinatorial Pattern Matching, pages 52–66, London, UK, 1992. Springer-Verlag. [Kec93]J. D. Kececioglu. The maximum weight trace problem in multiple sequence alignment. In CPM ’93: Proceedings of the 4th Annual Symposium on Combinatorial Pattern Matching, pages 106–119, London, UK, 1993. Springer-Verlag. [NHH00]C. Notredame, D.G. Higgins, and J. Heringa. TCoffee: A novel method for fast and accurate multiple sequence alignment. Journal of Molecular Biology., 302:205–217, 2000. [NW70]S. B. Needleman and C. D. Wunsch. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Molecular Biol., 48:443–453, 1970. [REW+08]Tobias Rausch, Anne-Katrin Emde, David Weese, Andreas Doring, Cedric Notredame, and Knut Reinert. Segment-based multiple sequence alignment. Bioinformatics, 24(16):i187–192, 2008. [SK83]D. Sankoff and J. B. Kruskal. Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison. Addison-Wesley, Reading, MA, 1983. [SW81]T . F . Smith and M. S. Waterman. Identification of common molecular subsequences. Journal of Molecular Biology, 147(1):195–197, 1981. [WE87]M. S. Waterman and M. Eggert. A new algorithm for best subsequence alignments with application to tRNA-rRNA comparisons. Journal of Molecular Biology, 197(4):723–728, 1987. Algorithmische Bioinformatik Monday, May 25,

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from

Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from

0. Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. students Beatrice Miron, Oana R at oi, Diana Popovici 1. PLAN

728 views • 36 slides
Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et

Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et

0. Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. student Diana Popovici M.Sc. student Oana R at oi [ MHC class I with peptide ] MHC = Major

726 views • 51 slides
CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation: A faint similarity between two sequences becomes very significant if present in many sequences Definition Given N sequences x 1 , x 2

626 views • 30 slides
Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F.

Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F.

Introduction Multiple Sequence Alignment Distributed Memory Shared Memory Computational Results Conclusions and Future Work Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F. A. Vasconcellos,

459 views • 21 slides
Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software

Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software

Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software to generate MSAs MAFFT (very good, very fast) http://mafft.cbrc.jp/alignment/software/ Clustal Omega (very good, very fast)

547 views • 25 slides
Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple

Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple

Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple Sequence Alignment Given k sequences S = { S 1 , S 2 , , S k } . A multiple alignment of S is a set of k equal- length sequences { S 1 ,

652 views • 47 slides
Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex:

Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex:

Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex: MSA of 4 sequences MQPILLLV, MLRLL, MKILLL, and MPPVLILV : MQPILLLV MLRLL-- MK-ILLL- MPPVLILV No column is all gaps Motivation Multiple

533 views • 39 slides
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's

Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's

Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... You first need to know... Multiple sequence alignment Substitution matrices Substitution matrices Phylogenetic trees

449 views • 41 slides
CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise

Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise

Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise alignment Infer biological relationships from string similarity Multiple alignment Infer string similarity from biological relationships

474 views • 36 slides
A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction

A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction

A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction Multiple alignment of protein sequences has become a fundamental tool in molecular biology evolutionary studies protein

294 views • 10 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
Taintless Defeating taint-powered protection techniques Abbas Naderi (aka AbiusX) Mandana

Taintless Defeating taint-powered protection techniques Abbas Naderi (aka AbiusX) Mandana

Taintless Defeating taint-powered protection techniques Abbas Naderi (aka AbiusX) Mandana Bagheri Shahin Ramezany Covered Topics y Before We Begin Taintless While you obtain the tools and get ready, well Describing the

465 views • 45 slides
Howdah a flexible pipeline framework and applications to analyzing genomic data Steven Lewis PhD

Howdah a flexible pipeline framework and applications to analyzing genomic data Steven Lewis PhD

Howdah a flexible pipeline framework and applications to analyzing genomic data Steven Lewis PhD slewis@systemsbiology.org What is a Howdah? A howdah is a carrier for an elephant The idea is that multiple tasks can be performed

531 views • 27 slides
Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010*

Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010*

British Columbia Cancer Agency Genome Sciences Centre Vancouver . British Columbia . Canada Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010* EBI*Interfaces*Interest*Forum* Cydney*Nielsen* Discovery*path*

483 views • 45 slides
Cutting Edge Genetics Research funding from Natera Made Easy Mary E Norton, MD Department of

Cutting Edge Genetics Research funding from Natera Made Easy Mary E Norton, MD Department of

12/8/2017 Disclosures Cutting Edge Genetics Research funding from Natera Made Easy Mary E Norton, MD Department of Obstetrics, Gynecology, and Reproductive Sciences University of California, San Francisco Why all the focus on Down

501 views • 16 slides
Crowd Production, Peer Production CS 278 | Stanford University | Michael Bernstein Last time

Crowd Production, Peer Production CS 278 | Stanford University | Michael Bernstein Last time

Crowd Production, Peer Production CS 278 | Stanford University | Michael Bernstein Last time Crowdsourcing: an open call to a large group of people who self- select to participate Crowds can be surprisingly intelligent, if opinions are

475 views • 46 slides
Lets start by Refreshing Memories In reminiscence of a time, when we were striving to built

Lets start by Refreshing Memories In reminiscence of a time, when we were striving to built

Lets start by Refreshing Memories In reminiscence of a time, when we were striving to built computation devices from technical modules with defined functions to perform complex operations In reminiscence of a time after that, when we

755 views • 27 slides
Internet-Wide Network Studies Previous research has shown promise of Internet-wide surveys Mining

Internet-Wide Network Studies Previous research has shown promise of Internet-wide surveys Mining

Fast Internet-Wide Scanning, ZMap Weak Keys and the HTTPS Certificate Ecosystem Zakir Durumeric Michael Bailey University of Michigan ZMap: Fast Internet-Wide Scanning, Weak Keys, and the HTTPS Certificate Ecosystem Zakir Durumeric

491 views • 46 slides
A Corporate Environment That Supports Healthy Lifestyles Deborah Napier, MS, CHES Gulf Power /

A Corporate Environment That Supports Healthy Lifestyles Deborah Napier, MS, CHES Gulf Power /

A Corporate Environment That Supports Healthy Lifestyles Deborah Napier, MS, CHES Gulf Power / Southern Company Why would you want to have a healthy community in the first place? Because it is a prerequisite for sustainable profitability

484 views • 16 slides

More recommend