sequence alignment
play

Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence - PowerPoint PPT Presentation

Nov 24, 2023 •301 likes •491 views

Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence Alignment Exercise: Transforming sequences 1 Write a function to return the antisense strand of a DNA Why compare sequences? Mark Voorhies Sequence Alignment Why compare

  1. Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence Alignment

  2. Exercise: Transforming sequences 1 Write a function to return the antisense strand of a DNA

  3. Why compare sequences? Mark Voorhies Sequence Alignment

  4. Why compare sequences? To find genes with a common ancestor To infer conserved molecular mechanism and biological function To find short functional motifs To find repetitive elements within a sequence To predict cross-hybridizing sequences (e.g. in microarray design) To predict nucleotide secondary structure Mark Voorhies Sequence Alignment

  5. Whiteboard Image Mark Voorhies Sequence Alignment

  6. Nomenclature Homologs heritable elements with a common evolutionary origin. Mark Voorhies Sequence Alignment

  7. Nomenclature Homologs heritable elements with a common evolutionary origin. Orthologs homologs arising from speciation. Paralogs homologs arising from duplication and divergence within a single genome. Mark Voorhies Sequence Alignment

  8. Nomenclature Homologs heritable elements with a common evolutionary origin. Orthologs homologs arising from speciation. Paralogs homologs arising from duplication and divergence within a single genome. Xenologs homologs arising from horizontal transfer. Onologs homologs arising from whole genome duplication. Mark Voorhies Sequence Alignment

  9. Dotplots 1 Unbiased view of all ungapped

  10. Dotplots 1 Unbiased view of all ungapped

  11. Types of alignments Global Alignment Each letter of each sequence is aligned to a letter or a gap ( e.g. , Needleman-Wunsch) Local Alignment An optimal pair of subsequences is taken from the two sequences and globally aligned ( e.g. , Smith-Waterman) Mark Voorhies Sequence Alignment

  12. Exercise: Scoring an ungapped alignment s =

  13. Exercise: Scoring an ungapped alignment s =

  14. Exercise: Scoring an ungapped alignment s =

  15. Exercise: Scoring an ungapped alignment s =

  16. Exercise: Scoring a gapped alignment 1 Given two equal length gapped sequences (where “-”

  17. Exercise: Scoring a gapped alignment 1 Given two equal length gapped sequences (where “-”

  18. Homework 1 Read chapter 3 of the BLAST book (Sequence Alignment).

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence Alignment Part I Motivation, dynamic programming, global alignment 3 Sequence Alignment What Why A Simple Algorithm Complexity

892 views • 56 slides
Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
CSCI 490 Bioinformatics Part II: Pair-wise Sequence Alignment Outline Whats the

CSCI 490 Bioinformatics Part II: Pair-wise Sequence Alignment Outline Whats the

CSCI 490 Bioinformatics Part II: Pair-wise Sequence Alignment Outline Whats the biological problem Algorithm issues Intro to dynamic programming Global sequence alignment Local sequence alignment More efficient

2.09k views • 163 slides
CSE 421 Midterm Scores Mean 83 Sigma 11 1 CSE 421 Algorithms Sequence Alignment 1 Sequence

CSE 421 Midterm Scores Mean 83 Sigma 11 1 CSE 421 Algorithms Sequence Alignment 1 Sequence

CSE 421 Midterm Scores Mean 83 Sigma 11 1 CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment Goal: position characters in strings so they best line up with one another We can do this via Dynamic Programming 2 What is an

475 views • 31 slides
Sequence Alignment: Mo1va1on and Algorithms Mo1va1on and

Sequence Alignment: Mo1va1on and Algorithms Mo1va1on and

Sequence Alignment: Mo1va1on and Algorithms Mo1va1on and Introduc1on Importance of Sequence Alignment For DNA, RNA and amino acid sequences, high sequence

1k views • 62 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
Sequence comparison: Sequence comparison: Significance of alignment scores

Sequence comparison: Sequence comparison: Significance of alignment scores

Sequence comparison: Sequence comparison: Significance of alignment scores http://faculty.washington.edu/jht/GS559_2014/ Genome 559: Introduction to Statistical and Computational Genomics d C i l G i Prof. James H. Thomas Unscaled EVD

781 views • 13 slides
CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation: A faint similarity between two sequences becomes very significant if present in many sequences Definition Given N sequences x 1 , x 2

626 views • 30 slides
CSE421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 8 Sequence Similarity: What G G A C C A T A C T A A G T C C A A T 9 Sequence Similarity: What G G A C C A T A C T A A G | : | : |

689 views • 26 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Similarity: What G G A C C A T A C T A A G T C C A A G 3 Sequence Similarity: What G G A C C A T A C T A A G | | |

644 views • 51 slides
Sequence Alignment Mark Voorhies 5/29/2013 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/29/2013 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/29/2013 Mark Voorhies Sequence Alignment Exercise: Scoring an ungapped alignment Given two sequences and a scoring matrix, find the offset that yields the best scoring ungapped alignment. Mark Voorhies

425 views • 5 slides
Sequence Alignment Mark Voorhies 5/20/2015 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/20/2015 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/20/2015 Mark Voorhies Sequence Alignment Exercise: Scoring an ungapped alignment Given two sequences and a scoring matrix, find the offset that yields the best scoring ungapped alignment. Mark Voorhies

406 views • 29 slides
Introduction to NGS Fotis E. Psomopoulos CODATA-RDA Advanced Bioinformatics Workshop, 19-23

Introduction to NGS Fotis E. Psomopoulos CODATA-RDA Advanced Bioinformatics Workshop, 19-23

Introduction to NGS Fotis E. Psomopoulos CODATA-RDA Advanced Bioinformatics Workshop, 19-23 August 2019, Trieste, Italy Sequencing Technology 2 Introduction to NGS Tuesday, August 20th 2019 Changes and Timing past decade 3 Introduction to

699 views • 37 slides
Prediction of noncoding RNAs with RNAz John Dzmil, III Steve Griesmer Philip Murillo April 4,

Prediction of noncoding RNAs with RNAz John Dzmil, III Steve Griesmer Philip Murillo April 4,

Prediction of noncoding RNAs with RNAz John Dzmil, III Steve Griesmer Philip Murillo April 4, 2007 What is non-coding RNA (ncRNA)? RNA molecules that are not translated into proteins Size range from 20 to1000s of nucleotides in

328 views • 30 slides
Lander-Waterman Statistics for Shotgun Sequencing Math 283: Ewens & Grant 5.1 Math 186: Not

Lander-Waterman Statistics for Shotgun Sequencing Math 283: Ewens & Grant 5.1 Math 186: Not

Lander-Waterman Statistics for Shotgun Sequencing Math 283: Ewens & Grant 5.1 Math 186: Not in book Prof. Tesler Math 186 & 283 Winter 2019 Prof. Tesler 5.1 Shotgun Sequencing Math 186 & 283 / Winter 2019 1 / 36 Genome

393 views • 36 slides
Dictionaries A Good morning dictionary English: Good morning Spanish: Buenas das

Dictionaries A Good morning dictionary English: Good morning Spanish: Buenas das

Dictionaries A Good morning dictionary English: Good morning Spanish: Buenas das Swedish: God morgon German: Guten morgen Venda: Ndi matscheloni Afrikaans: Goeie mre Whats a dictionary? A dictionary is a table of items. Each

560 views • 35 slides
Random Walk Inference and Learning in A Large Scale Knowledge Base Anshul Bawa Adapted from

Random Walk Inference and Learning in A Large Scale Knowledge Base Anshul Bawa Adapted from

Random Walk Inference and Learning in A Large Scale Knowledge Base Anshul Bawa Adapted from slides by : Ni Lao, Tom Mitchell, William W. Cohen 6 March 2017 Outline Inference in Knowledge Bases The NELL project and N-FOIL Random

542 views • 39 slides
Information & Entropy Comp 595 DM Professor Wang Information & Entropy Information

Information & Entropy Comp 595 DM Professor Wang Information & Entropy Information

Information & Entropy Comp 595 DM Professor Wang Information & Entropy Information Equation p = probability of the event happening b = base (base 2 is mostly used in information theory) *unit of information is determined by base

226 views • 9 slides
INF 111 / CSE 121: Software Tools and Methods Lecture Notes for Fall Quarter, 2007 Michele

INF 111 / CSE 121: Software Tools and Methods Lecture Notes for Fall Quarter, 2007 Michele

INF 111 / CSE 121: Software Tools and Methods Lecture Notes for Fall Quarter, 2007 Michele Rousseau Set 18 (Some notes adapted from Susan E. Sim & UML Distilled) Announcements Homework Due 11/21 @ 3p TA will be available for

806 views • 8 slides
CSE 182: Biological Data Analysis Instructor: Vineet Bafna TA: Ryan Kelley www. www.cse cse.

CSE 182: Biological Data Analysis Instructor: Vineet Bafna TA: Ryan Kelley www. www.cse cse.

CSE 182: Biological Data Analysis Instructor: Vineet Bafna TA: Ryan Kelley www. www.cse cse. .ucsd ucsd. .edu edu/classes/fa05/cse182 /classes/fa05/cse182 Databases Biological databases are diverse Often, little more than large

719 views • 44 slides

More recommend