Role of CSIRO Australian Animal Health Laboratory in the emergency response to the white spot disease outbreak in farmed prawns in Queensland, 2016-17 AUSTRALIAN ANIMAL HEALTH LABORATORY (AAHL) Moody NJG , Mohr PG, Hoad J, Williams LM, Cummins DM, Slater J, Crane MStJ and Eagles D Ridley Australian Prawn Farmers Symposium - A New Horizon
Prawn aquaculture globally • Crustaceans: A$47,535,300,000 (FAO, 2015) • Penaeus vannamei : A$24,258,000,000 • Penaeus monodon : A$5,113,810,000 • Australia imports a lot of prawns http://www.greenpeace.org Vietnam China Thailand Nick Moody | AAHL WSSV response
AFDL’s role in aquatic disease responses Diagnostic submissions from State authorities: Category 1: Routine samples (e.g. health surveillance, no disease suspected, fee-for-service) Category 2: Exotic disease exclusion (low likelihood) – test results required within 72 hours Category 3: Exotic disease exclusion/confirmation (high likelihood) – test results required within 24 hours. Diagnostic test report issued to submitting laboratory, CVO of the submitting state, Australian CVO and Director of AAHL. Nick Moody | AAHL WSSV response
Category 3 submissions (aquatic) 1. State CVO contacts head of AAHL Fish Diseases Laboratory (AFDL) 2. Head of AFDL notifies staff to expect Category 3 samples and briefs Director of AAHL on the situation 3. Samples arrive and testing strategy confirmed 4. Testing conducted immediately and continuously until a result is obtained 5. Results discussed with Director of AAHL 6. Diagnostic test report forwarded to (1) submitting laboratory, (2) state CVO and (3) the Australian CVO (Australian OIE delegate) within 24 hours (even if it is only an interim report with final report to follow as soon as testing is complete) 7. Positive results will trigger aqCCEAD teleconference Nick Moody | AAHL WSSV response
Prawns submitted for WSSV confirmation November 30, 2016: Samples received from Queensland laboratory at 8:30pm December 1, 2016: WSSV qPCR POSITIVE result at ~1:00am, WSSV OIE PCR POSITIVE and sequence reported at 9:30am, aqCCEAD convened, OIE notified Nick Moody | AAHL WSSV response
Index pond was very positive OIE WSSV qPCR amplification curves for samples (orange) and positive (black) and negative (blue)controls. CSIRO WSSV qPCR amplification curves for samples (orange) and positive (black) and negative (blue) controls. Nick Moody | AAHL WSSV response
Confirmation by sequence analysis Shares 100% nucleotide identity with WSSV in the NCBI database, including WSSV TTCTCTCTTGATAGCTAGAGCAAAGGCATTTTGGTTAGTATTTGGTGGACAGTTAGTATAGTCAGAAGAAATATTACGTTCGATATCGTTGAGGATATCCTTGAATTCAGCATCAGTTACTTGCTTAGAGATGGCTTCGAAAACTCGAGCCAAATGCTTACGAAGAGTAGTGTTAGAAGAGGAAGAATAGGTAGAGGATACGGCAGCTGCTGCACCTTGTTCGGCGTTCTTTTCTTCGAATGTA TCTCCCTTTGACAGAAGGAAATCAAAGGCGAGAGGGCCGCTGGCGCATGAGGCGAATGGTACATTTTCCGGGCGAGCTGCCTTGCCGGAAATTAGTGTGTGATAGACGGCATTCTTCATGGCTTCTGAGATGAGGACGGGACCATTGTTGGATGTTGTTTCGCTATCTTCATAATCCATTGATTCTACTCCTCCATTATTATTAGATTTGAAGAGGTCGTCAGAGCCTAGTCTATCAATCATTTC CTTGGTGTTTTCATATACGCTTTCTGGTACAGATTCAGCGATGGTGCCGGCCAGTTCGTTCACGATAACCTTTCCAAGATCGGCGATAAGTTGTTCCAAAACATTAGCAAACACGACAGTTTGAGCGTTCATTGTGCTCTTTTGGATGTATCTGTTCCTTGGCAGAGCATTCTGGATCAGTTCAGATTCGTTACCGTTTCCATCGGTTGCCTGGAAGACGGCTGGCATGGCTGAAGCGACAGTTCC CTTGGCGTCGGCGGTGCACACGTGCTGGCGATGACATTCCAATATTCCTAGTACACTTCTTGCATTATTTGGTTTGACAATAACGTCGAGGTTGACTCCTGCCGTTGTCATGCCAGAGTTGGAGAGGGCGAGTCTTGATGGTTCAAATGTTCCATTAAAGTTGGAGTTCATTCTCATTTCAGTCCATTCGCTAACCTTCTTAAGGAGGGAAGATCCTGTTACTCTAGAATCGATCTTGGACATGTT CATCACGTAATGTTTGTCACTAATAAGCTTGTTGGCCTGATAGGGTGTGGCTCTAATTTCTTCCATGGAGACTTCTGGGCGGGCGAATGCGAAAGAGGATACCAGATGCTCGTTATCTGAGGGAGTAAAAGTGTGGTGGAGATGGAAGGGGCAGTTACAATTTTGCTTGTGGGACATGGCGTATTCGTCCCCATATCTTCCCAAGAATTTCTCAAATCGTTCAATGTTCTTGAAGAAGCATTGA GTATCAGTCATGTGCAATTTGATGTTGTCCATGAAAGATGACTTTGTATGGGAATCCATGGAAGAAAGCATGAGGTGAGAAGCGCAGGTGAGGGCGGCAGGGAAGGCTGGGTCAA Whole genome sequencing at AAHL of samples from 1IP, 5IP and northern Moreton Bay indicate it was not a multiple source incursion Nick Moody | AAHL WSSV response
Variable interlaboratory test results Laboratories for Emergency Animal Disease Diagnosis and Response (LEADDR) • Strategy The network will standardize or otherwise harmonise testing services and coordinate large-scale testing capacity to provide effective diagnosis and management of outbreaks of EAD. The network will predominately focus on diseases of livestock, but may also include EADs of non-livestock species. • Objectives 1. To establish a national system for the surveillance and diagnosis of EADs using harmonised laboratory testing services across a network of approved laboratories. 2. Establish a network-supported national surge capacity for EAD outbreak. • Options 1. LEADDR coordinator can observe CCEAD meetings and update LEADDR Coordinating Committee if appropriate 2. LEADDR Coordinating Committee can establish a working group to investigate any issues with diagnostic test results Nationally co-ordinated approach to diagnostic testing for EADs Nick Moody | AAHL WSSV response
Enacted the AAHL EDRP – 9 December, 2016 • AAHL Emergency Disease Response Plan • This plan has been drawn up to describe the range of resources that must be provided within AAHL in the event of responding to an outbreak of an emergency disease and to outline the organisational structure required to meet the demand for technical excellence, quality performance and efficient laboratory output. • The activation of the plan is the responsibility of AAHL’s Director (or delegate) who will also appoint the Laboratory Response Coordinator. It is the Laboratory Response Coordinator’s responsibility to implement the plan, together with the assistance of the Scientific Services, Veterinary Services and Resources Coordinators. • Role descriptions and responsibilities are set out in job cards. To ensure that the handover of a role is carried out with minimal loss of function, debriefing will take place. • Laboratory Response Co-ordinator: Dr Debbie Eagles • Veterinary Services Co-ordinator: Dr Mark Crane • Scientific Services Co-ordinator: Dr Peter Mohr • Resource Co-ordinator: Dr Nick Moody • Everyone in AAHL available for the response • End of Emergency Laboratory Response – 19 July, 2017 Nick Moody | AAHL WSSV response
Largest disease outbreak in Australia Number of Samples 1000 1500 2000 2500 3000 3500 500 0 Nick Moody | AAHL WSSV response 29/11/2016 30/11/16 1IP 1/12/16 2/12/16 *3/12/2016 *4/12/2016 5/12/16 6/12/16 2IP 7/12/16 3IP 8/12/16 9/12/16 *10/12/2016 *11/12/2016 12/12/16 13/12/16 4IP 14/12/16 15/12/16 16/12/16 *17/12/2016 *18/12/2016 19/12/16 Queensland (Farmed and wild) 20/12/16 21/12/16 22/12/16 23/12/16 *24/12/2016 *25/12/2016 *26/12/2016 27/12/16 28/12/16 5IP 29/12/16 6IP 30/12/16 *31/12/2016 *1/01/2017 2/01/17 3/01/17 4/01/17 Date Received 5/01/17 6/01/17 *7/01/2017 Commodity (Imported and retail) *8/01/2017 9/01/17 10/01/17 11/01/17 12/01/17 13/01/17 *14/01/2017 - - - - - WSSV Emergency Response 2016-17 *15/01/2017 16/01/17 17/01/17 45+ teleconferences Various other submissions 1,687 Commodity samples (15,183 tests) Process ~1000 samples/day 22,449 Farmed and wild samples (43,731 tests) 18/01/17 19/01/17 20/01/17 *21/01/2017 *22/01/2017 23/01/17 24/01/17 25/01/17 *26/01/2017 27/01/17 *28/01/2017 *29/01/2017 30/01/17 31/01/16 1/02/17 2/02/17 3/02/17 *4/02/2017 *5/02/2017 6/02/17 7/02/17 8/02/17 9/02/17 10/02/17 *11/02/2017 *12/02/2017 7IP 13/02/17 14/02/17 15/02/17 16/02/17 17/02/17 *18/02/2017 *19/02/2017 20/02/17 21/02/17
A logistical challenge • Specimen receipt (4-8 staff) • Unpacking, specimen registration, tube labelling • Sorting to 96-well format • Sample preparation (8-10 staff) • 8 staff • PBSA to bead beating tubes, samples to bead tubes, bead beating (5 bead-beaters) • Limited robotics • Nucleic acid extraction (3-4 staff) • Sample clarification, buffer preparation • 2 x MME-96 systems • Very important robotics • Real-time PCR (3-4 staff) • Loading • Data retrieval and analysis • 6 x 7500 FAST Thermal Cyclers Nick Moody | AAHL WSSV response
A logistical challenge • 203 x 5ml TaqMan Fast Universal Master Mix • 44 x 5x MagMax-96 Viral 1 Kit • 29,000 x 2mL Lysis Matrix M tubes (purchased the entire Australian stock – twice) • Purchase Order with Thermo Fisher (Life Technologies) • Other companies happy for me to pay when I got the invoice Nick Moody | AAHL WSSV response
A logistical challenge Nick Moody | AAHL WSSV response
Potential sources • People fishing in the Logan River using supermarket prawns as bait • Supermarket prawns: WSSV POSITIVE (different labs) • Raw, unprocessed prawn import ban: 6 Jan, 2017 (ended) • Historical WSSV levels in prawns tested post-arrival: 4 – 23% WSSV POSITIVE • Enhanced surveillance testing: up to 72% WSSV POSITIVE, some C T values <20 • Six importers with licences suspended – ongoing investigations • Senate Estimates Committee: Rural and Regional Affairs and Transport 24/5/17 [http://www.aph.gov.au/Parliamentary_Business/Hansard/Estimates_Transcript_Schedule] • Still no definitive cause (may never be known) • Whole genome sequencing (within and between country variation) • 2016: shortage of prawns in Vietnam and China so imports form other countries for processing and export Nick Moody | AAHL WSSV response
Recommend
More recommend
