Role of CSIRO Australian Animal Health Laboratory in the emergency - - PowerPoint PPT Presentation

AUSTRALIAN ANIMAL HEALTH LABORATORY (AAHL)

Moody NJG, Mohr PG, Hoad J, Williams LM, Cummins DM, Slater J, Crane MStJ and Eagles D

Role of CSIRO Australian Animal Health Laboratory in the emergency response to the white spot disease outbreak in farmed prawns in Queensland, 2016-17

Ridley Australian Prawn Farmers Symposium - A New Horizon

Prawn aquaculture globally

• Crustaceans: A$47,535,300,000 (FAO, 2015)
• Penaeus vannamei: A$24,258,000,000
• Penaeus monodon: A$5,113,810,000
• Australia imports a lot of prawns

Nick Moody | AAHL WSSV response

http://www.greenpeace.org

Vietnam China Thailand

AFDL’s role in aquatic disease responses

Nick Moody | AAHL WSSV response

Diagnostic submissions from State authorities: Category 1: Routine samples (e.g. health surveillance, no disease suspected, fee-for-service) Category 2: Exotic disease exclusion (low likelihood) – test results required within 72 hours Category 3: Exotic disease exclusion/confirmation (high likelihood) – test results required within 24 hours. Diagnostic test report issued to submitting laboratory, CVO of the submitting state, Australian CVO and Director of AAHL.

Category 3 submissions (aquatic)

Nick Moody | AAHL WSSV response

1. State CVO contacts head of AAHL Fish Diseases Laboratory (AFDL) 2. Head of AFDL notifies staff to expect Category 3 samples and briefs Director of AAHL on the situation 3. Samples arrive and testing strategy confirmed 4. Testing conducted immediately and continuously until a result is obtained 5. Results discussed with Director of AAHL 6. Diagnostic test report forwarded to (1) submitting laboratory, (2) state CVO and (3) the Australian CVO (Australian OIE delegate) within 24 hours (even if it is only an interim report with final report to follow as soon as testing is complete) 7. Positive results will trigger aqCCEAD teleconference

Prawns submitted for WSSV confirmation

Nick Moody | AAHL WSSV response

November 30, 2016: Samples received from Queensland laboratory at 8:30pm December 1, 2016: WSSV qPCR POSITIVE result at ~1:00am, WSSV OIE PCR POSITIVE and sequence reported at 9:30am, aqCCEAD convened, OIE notified

Index pond was very positive

Nick Moody | AAHL WSSV response

OIE WSSV qPCR amplification curves for samples (orange) and positive (black) and negative (blue)controls. CSIRO WSSV qPCR amplification curves for samples (orange) and positive (black) and negative (blue) controls.

Confirmation by sequence analysis

Nick Moody | AAHL WSSV response

Shares 100% nucleotide identity with WSSV in the NCBI database, including WSSV

TTCTCTCTTGATAGCTAGAGCAAAGGCATTTTGGTTAGTATTTGGTGGACAGTTAGTATAGTCAGAAGAAATATTACGTTCGATATCGTTGAGGATATCCTTGAATTCAGCATCAGTTACTTGCTTAGAGATGGCTTCGAAAACTCGAGCCAAATGCTTACGAAGAGTAGTGTTAGAAGAGGAAGAATAGGTAGAGGATACGGCAGCTGCTGCACCTTGTTCGGCGTTCTTTTCTTCGAATGTA TCTCCCTTTGACAGAAGGAAATCAAAGGCGAGAGGGCCGCTGGCGCATGAGGCGAATGGTACATTTTCCGGGCGAGCTGCCTTGCCGGAAATTAGTGTGTGATAGACGGCATTCTTCATGGCTTCTGAGATGAGGACGGGACCATTGTTGGATGTTGTTTCGCTATCTTCATAATCCATTGATTCTACTCCTCCATTATTATTAGATTTGAAGAGGTCGTCAGAGCCTAGTCTATCAATCATTTC CTTGGTGTTTTCATATACGCTTTCTGGTACAGATTCAGCGATGGTGCCGGCCAGTTCGTTCACGATAACCTTTCCAAGATCGGCGATAAGTTGTTCCAAAACATTAGCAAACACGACAGTTTGAGCGTTCATTGTGCTCTTTTGGATGTATCTGTTCCTTGGCAGAGCATTCTGGATCAGTTCAGATTCGTTACCGTTTCCATCGGTTGCCTGGAAGACGGCTGGCATGGCTGAAGCGACAGTTCC CTTGGCGTCGGCGGTGCACACGTGCTGGCGATGACATTCCAATATTCCTAGTACACTTCTTGCATTATTTGGTTTGACAATAACGTCGAGGTTGACTCCTGCCGTTGTCATGCCAGAGTTGGAGAGGGCGAGTCTTGATGGTTCAAATGTTCCATTAAAGTTGGAGTTCATTCTCATTTCAGTCCATTCGCTAACCTTCTTAAGGAGGGAAGATCCTGTTACTCTAGAATCGATCTTGGACATGTT CATCACGTAATGTTTGTCACTAATAAGCTTGTTGGCCTGATAGGGTGTGGCTCTAATTTCTTCCATGGAGACTTCTGGGCGGGCGAATGCGAAAGAGGATACCAGATGCTCGTTATCTGAGGGAGTAAAAGTGTGGTGGAGATGGAAGGGGCAGTTACAATTTTGCTTGTGGGACATGGCGTATTCGTCCCCATATCTTCCCAAGAATTTCTCAAATCGTTCAATGTTCTTGAAGAAGCATTGA GTATCAGTCATGTGCAATTTGATGTTGTCCATGAAAGATGACTTTGTATGGGAATCCATGGAAGAAAGCATGAGGTGAGAAGCGCAGGTGAGGGCGGCAGGGAAGGCTGGGTCAA

Whole genome sequencing at AAHL of samples from 1IP, 5IP and northern Moreton Bay indicate it was not a multiple source incursion

Variable interlaboratory test results

Nick Moody | AAHL WSSV response

Laboratories for Emergency Animal Disease Diagnosis and Response (LEADDR)

• Strategy

The network will standardize or otherwise harmonise testing services and coordinate large-scale testing capacity to provide effective diagnosis and management of outbreaks of EAD. The network will predominately focus on diseases of livestock, but may also include EADs of non-livestock species.

• Objectives
• 1. To establish a national system for the surveillance and diagnosis of EADs using harmonised laboratory testing

services across a network of approved laboratories.

• 2. Establish a network-supported national surge capacity for EAD outbreak.
• Options
• 1. LEADDR coordinator can observe CCEAD meetings and update LEADDR Coordinating Committee if

appropriate

• 2. LEADDR Coordinating Committee can establish a working group to investigate any issues with diagnostic test

results

 Nationally co-ordinated approach to diagnostic testing for EADs

Enacted the AAHL EDRP – 9 December, 2016

Nick Moody | AAHL WSSV response

• AAHL Emergency Disease Response Plan
• This plan has been drawn up to describe the range of resources that must be provided within AAHL in the

event of responding to an outbreak of an emergency disease and to outline the organisational structure required to meet the demand for technical excellence, quality performance and efficient laboratory output.

• The activation of the plan is the responsibility of AAHL’s Director (or delegate) who will also appoint the

Laboratory Response Coordinator. It is the Laboratory Response Coordinator’s responsibility to implement the plan, together with the assistance of the Scientific Services, Veterinary Services and Resources Coordinators.

• Role descriptions and responsibilities are set out in job cards. To ensure that the handover of a role is

carried out with minimal loss of function, debriefing will take place.

• Laboratory Response Co-ordinator: Dr Debbie Eagles
• Veterinary Services Co-ordinator: Dr Mark Crane
• Scientific Services Co-ordinator: Dr Peter Mohr
• Resource Co-ordinator: Dr Nick Moody
• Everyone in AAHL available for the response
• End of Emergency Laboratory Response – 19 July, 2017

Largest disease outbreak in Australia

Nick Moody | AAHL WSSV response 500 1000 1500 2000 2500 3000 3500 29/11/2016 30/11/16 1/12/16 2/12/16 *3/12/2016 *4/12/2016 5/12/16 6/12/16 7/12/16 8/12/16 9/12/16 *10/12/2016 *11/12/2016 12/12/16 13/12/16 14/12/16 15/12/16 16/12/16 *17/12/2016 *18/12/2016 19/12/16 20/12/16 21/12/16 22/12/16 23/12/16 *24/12/2016 *25/12/2016 *26/12/2016 27/12/16 28/12/16 29/12/16 30/12/16 *31/12/2016 *1/01/2017 2/01/17 3/01/17 4/01/17 5/01/17 6/01/17 *7/01/2017 *8/01/2017 9/01/17 10/01/17 11/01/17 12/01/17 13/01/17 *14/01/2017 *15/01/2017 16/01/17 17/01/17 18/01/17 19/01/17 20/01/17 *21/01/2017 *22/01/2017 23/01/17 24/01/17 25/01/17 *26/01/2017 27/01/17 *28/01/2017 *29/01/2017 30/01/17 31/01/16 1/02/17 2/02/17 3/02/17 *4/02/2017 *5/02/2017 6/02/17 7/02/17 8/02/17 9/02/17 10/02/17 *11/02/2017 *12/02/2017 13/02/17 14/02/17 15/02/17 16/02/17 17/02/17 *18/02/2017 *19/02/2017 20/02/17 21/02/17

Number of Samples Date Received

Queensland (Farmed and wild) Commodity (Imported and retail)

2IP 3IP 4IP 5IP 6IP 7IP 1IP

WSSV Emergency Response 2016-17

• 22,449 Farmed and wild samples (43,731 tests)
• Process ~1000 samples/day
• 1,687 Commodity samples (15,183 tests)
• Various other submissions
• 45+ teleconferences

A logistical challenge

Nick Moody | AAHL WSSV response

• Specimen receipt (4-8 staff)
• Unpacking, specimen registration, tube labelling
• Sorting to 96-well format
• Sample preparation (8-10 staff)
• 8 staff
• PBSA to bead beating tubes, samples to bead tubes, bead beating (5 bead-beaters)
• Limited robotics
• Nucleic acid extraction (3-4 staff)
• Sample clarification, buffer preparation
• 2 x MME-96 systems
• Very important robotics
• Real-time PCR (3-4 staff)
• Loading
• Data retrieval and analysis
• 6 x 7500 FAST Thermal Cyclers

A logistical challenge

Nick Moody | AAHL WSSV response

• 203 x 5ml TaqMan Fast Universal Master Mix
• 44 x 5x MagMax-96 Viral 1 Kit
• 29,000 x 2mL Lysis Matrix M tubes

(purchased the entire Australian stock – twice)

• Purchase Order with Thermo Fisher (Life Technologies)
• Other companies happy for me to pay when I got the invoice

A logistical challenge

Nick Moody | AAHL WSSV response

Potential sources

Nick Moody | AAHL WSSV response

• People fishing in the Logan River using supermarket prawns as bait
• Supermarket prawns: WSSV POSITIVE (different labs)
• Raw, unprocessed prawn import ban: 6 Jan, 2017 (ended)
• Historical WSSV levels in prawns tested post-arrival: 4 – 23% WSSV POSITIVE
• Enhanced surveillance testing: up to 72% WSSV POSITIVE, some CT values <20
• Six importers with licences suspended – ongoing investigations
• Senate Estimates Committee: Rural and Regional Affairs and Transport 24/5/17

[http://www.aph.gov.au/Parliamentary_Business/Hansard/Estimates_Transcript_Schedule]

• Still no definitive cause (may never be known)
• Whole genome sequencing (within and between country variation)
• 2016: shortage of prawns in Vietnam and China so imports form other countries for

processing and export

Summary

Nick Moody | AAHL WSSV response

• WSSV resulted in destruction of all farmed prawns in the Logan

River area

Summary

Nick Moody | AAHL WSSV response

• WSSV resulted in destruction of all farmed prawns in the Logan

River area

• WSSV has been detected in wild prawns and crabs in Moreton Bay

Summary

Nick Moody | AAHL WSSV response

• WSSV resulted in destruction of all farmed prawns in the Logan

River area

• WSSV has been detected in wild prawns and crabs in Moreton Bay
• WSSV has been detected over 72% of retail prawns tested

Summary

Nick Moody | AAHL WSSV response

• WSSV resulted in destruction of all farmed prawns in the Logan

River area

• WSSV has been detected in wild prawns and crabs in Moreton Bay
• WSSV has been detected up to 72% of retail prawns tested

We really should try and keep exotic pathogens exotic

Summary

Nick Moody | AAHL WSSV response

• Should be a review to look at what worked well and what didn’t

work so well.

• What’s the plan if it happens again in the same area, or occurs

somewhere else?

Acknowledgements

Nick Moody | AAHL WSSV response

Staff from all areas of AAHL have been involved in the emergency disease response:

• AFDL Aquatic Diagnostic Capability Team
• AAHL Senior Management
• AAHL Fish Diseases Laboratory
• Diagnosis, Surveillance and Response teams
• Health & Biosecurity
• Engineering
• Stores
• Laundry
• Finance
• Administrative staff
• LabCabs
• SFS Pharma Logistics
• Department of Agriculture and Water Resources

Nick Moody

Team Leader, Aquatic Diagnostic Capability Senior Research Scientist

t +61 3 5227 5749 e nick.moody@csiro.au

AUSTRALIAN ANIMAL HEALTH LABORATORY (AAHL)

Thank you