RNA-seq read mapping Pr Engstrm SciLifeLab - PowerPoint PPT Presentation

RNA-­‑seq ¡read ¡mapping ¡ ¡ Pär ¡Engström ¡ ¡ SciLifeLab ¡RNA-­‑seq ¡workshop ¡ April ¡2016 ¡

Input: ¡sequence ¡reads ¡(FASTQ ¡format) ¡ @D2BJQQN1:142:C03FNACXX:5:1101:12935:2174 1:N:0:GCCAAT ATGCTGTGCAGGGCCTTGAGAACATGCGGGGGAATACATGTGGGTTTTTGG + =??DDDDD2,4<D2+4AE################################# @D2BJQQN1:142:C03FNACXX:5:1101:13035:2084 1:N:0:GCCAAT TTTCTATAGTTCGTTACTAGAGAAGTTTTTTTGATTGTGTGGGGGTCCGGG + =??DD2=23AD,3CE223,3+3+33<CF+4)0?)*19?DD########### @D2BJQQN1:142:C03FNACXX:5:1101:13322:2013 1:Y:0:GCCAAT CGTTCCCGTGGTGGGATTTTTGGGTGGCAGGGGACTTCGGTTGGGGGATTT + :>>A2+20<AC@CC)+4@2<+1?AAA######################### @D2BJQQN1:142:C03FNACXX:5:1101:13460:2061 1:Y:0:GCCAAT CCGCGGTCGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGTGGGGTTTTTG + =??DDDD)<C):?###################################### …

Goal: ¡reads ¡mapped ¡to ¡genome ¡ 2 kb Scale hg19 chr2: 136,872,000 136,873,000 136,874,000 136,875,000 136,876,000 Gm12878 RNA-seq reads 40 _ Gm12878 RNA-seq coverage, minus strand Gm12878_minus 0 _ RefSeq Genes CXCR4 CXCR4 4.88 _ 100 vertebrates Basewise Conservation by PhyloP 100 Vert. Cons 0 - -4.5 _ Simple Nucleotide Polymorphisms (dbSNP 144) Found in >= 1% of Samples Common SNPs(144) Repeating Elements by RepeatMasker RepeatMasker

����������� ������������� � � � � � � � � � � � ��������������������������������������������� � � � ������ ������ ��� �������������������� ������ ������ ��� �������������������� ����������������� ������������������ � � �� � Spliced ¡alignment ¡ k ���������� Garber ¡et ¡al. ¡ Nature ¡Methods ¡2011 ¡

Introns ¡can ¡be ¡very ¡large! ¡ Human introns (Ensembl) 1.0 0.8 Cumulative proportion 0.6 0.4 0.2 0.0 10 100 1,000 10,000 100,000 1M 10M Intron size (bp)

Limited ¡sequence ¡signals ¡at ¡splice ¡sites ¡ 5’ss 3’ss BP H. sapiens -3 -3 -2 -2 -1 -1 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 0 0 1 1 2 2 3 3 4 4 5 5 -12 -11 -10 D. rerio -1 -3 -2 -1 -12 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 0 0 1 2 3 4 5 GT…AG ¡ 98.6% ¡ D. melanogaster -3 -2 -1 0 1 3 4 5 2 -9 -8 -7 -6 GC…AG ¡ -5 -4 -3 -2 -1 0 1.3% ¡ -12 -11 -10 P. chrysosporium AT…AC ¡ 0.1% ¡ -3 -2 -1 0 1 2 3 4 5 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 -12 -11 -10 S. cerevisiae -3 -2 -1 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 0 1 2 3 4 5 -12 -11 -10 P. tricornutum -3 -2 -1 0 1 3 4 5 -9 -8 -7 -6 -5 -4 -3 -2 -1 0 2 -12 -11 -10 A. thaliana -3 -2 -1 0 1 3 4 5 -1 2 -12 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 0 Iwata ¡and ¡Gotoh ¡ BMC ¡Genomics ¡ 2011 ¡

MulX-­‑mapping ¡reads ¡and ¡pseudogenes ¡ FuncXonal ¡gene ¡ Processed ¡pseudogene ¡ Correct ¡read ¡alignment ¡ Incorrect ¡read ¡alignment ¡ IdenXcal, ¡spliced ¡ Mismatches, ¡not ¡spliced ¡ Note: ¡ • An ¡aligner ¡may ¡report ¡both ¡alignments ¡or ¡either ¡ • Some ¡search ¡strategies ¡and ¡scoring ¡schemes ¡give ¡preference ¡to ¡unspliced ¡alignments ¡

Current ¡RNA-­‑seq ¡aligners ¡ TopHat2 ¡ Kim ¡et ¡al. ¡ Genome ¡Biology ¡2013 ¡ HISAT ¡& ¡HISAT2 ¡ Kim ¡et ¡al. ¡ Nature ¡Methods ¡ 2015 ¡ STAR ¡ Dobin ¡et ¡al. ¡ Bioinforma8cs ¡ 2013 ¡ GSNAP ¡ Wu ¡and ¡Nacu ¡ Bioinforma8cs ¡ 2010 ¡ OLego ¡ Wu ¡et ¡al. ¡ Nucleic ¡Acids ¡Research ¡ 2013 ¡ HPG ¡aligner ¡ Medina ¡et ¡al. ¡ DNA ¡Research ¡2016 ¡ MapSplice2 ¡ hap://www.netlab.uky.edu/p/bioinfo/MapSplice2 ¡

The ¡predecessor: ¡BLAT ¡ “In ¡the ¡process ¡of ¡assembling ¡and ¡annotaXng ¡the ¡human ¡genome, ¡I ¡was ¡faced ¡ with ¡two ¡very ¡large-­‑scale ¡alignment ¡problems: ¡aligning ¡three ¡million ¡ESTs ¡and ¡ aligning ¡13 ¡million ¡mouse ¡whole-­‑genome ¡random ¡reads ¡against ¡the ¡human ¡ genome. ¡These ¡alignments ¡needed ¡to ¡be ¡done ¡in ¡less ¡than ¡two ¡weeks’ ¡Xme ¡ on ¡a ¡moderate-­‑sized ¡(90 ¡CPU) ¡Linux ¡cluster ¡in ¡order ¡to ¡have ¡Xme ¡to ¡process ¡ an ¡updated ¡genome ¡every ¡month ¡or ¡two. ¡To ¡achieve ¡this ¡I ¡developed ¡a ¡very-­‑ high-­‑speed ¡mRNA/DNA ¡and ¡translated ¡protein ¡alignment ¡algorithm. ¡“ ¡ ¡ (Kent ¡ Genome ¡Research ¡ 2002) ¡ ¡

InnovaXons ¡in ¡RNA-­‑seq ¡alignment ¡soiware ¡ • Read ¡pair ¡alignment ¡ • Consider ¡base ¡call ¡quality ¡scores ¡ • SophisXcated ¡indexing ¡to ¡decrease ¡CPU ¡and ¡memory ¡usage ¡ ¡ • Map ¡to ¡geneXc ¡variants ¡ • Resolve ¡mulX-­‑mappers ¡using ¡regional ¡read ¡coverage ¡ • Consider ¡juncXon ¡annotaXon ¡ • Two-­‑step ¡approach ¡(juncXon ¡discovery ¡& ¡final ¡alignment) ¡ ¡

Two-­‑step ¡RNA-­‑seq ¡read ¡mapping ¡ 1 st )run)of)HISAT)to)discover)splice)sites) mapped) ) ) ) ) e1# e2# e3# ) ) ) ) unmapped) 2 nd )run)of)HISAT)to)align)reads)by)making)use)of)the)list)of)splice)sites)collected)above) ) ) ) ) e1# e2# e3# ) ) ) ) Read) Global)Search) Exon) Local)Search) Intron) Extension) Junc:on)extension) Kim ¡et ¡al. ¡ Nature ¡Methods ¡ 2015 ¡ Thi

Mapping ¡accuracy ¡ Correctly and uniquely Correctly mapped Incorrectly Unmapped mapped (multimapped) mapped 92.1 91.6 92.3 88.9 96.7 97.6 97.6 94.4 % (93.5) (91.6) (93.8) (90.5) (99) (99.2) (99.3) (97.4) ( % + %) 100 Percentage of reads 75 50 25 0 OLego GSNAP STAR HISAT TopHat2 HISAT × 1 STAR × 2 HISAT × 2 Accuracy ¡for ¡20 ¡million ¡simulated ¡human ¡100 ¡bp ¡reads ¡with ¡0.5% ¡mismatch ¡rate ¡ ¡ Kim ¡et ¡al. ¡ Nature ¡Methods ¡ 2015 ¡

Mapping ¡accuracy ¡for ¡reads ¡with ¡small ¡anchors ¡ Correctly and uniquely Correctly mapped Incorrectly Unmapped mapped (multimapped) mapped 88.2 88.5 90.4 51.1 94.4 97.2 97.2 93.5 % (89.4) (88.5) (91.7) (52.2) (96.4) (98.9) (99) (95.5) ( % + %) Percentage of reads, 100 75 2M_8_15 50 25 b 0 62.4% (M) 7.6 0 9.2 0 79.8 94.4 95.4 77.8 % (7.7) (0) (9.4) (0) (92.6) (97.3) (98.3) (96) ( % + %) Percentage of reads, 100 75 2M_1_7 3.1% (gt_2M) 50 4.2% (2M_1_7) 25 5.1% (2M_8_15) 0 25.1% (2M_gt_15) OLego GSNAP STAR HISAT TopHat2 HISAT × 1 STAR × 2 HISAT × 2 Kim ¡et ¡al. ¡ Nature ¡Methods ¡ 2015 ¡

Mapping ¡accuracy ¡for ¡spliced ¡RNA-­‑seq ¡reads ¡ Simulation 1 Simulation 2 BAGET ann GEM ann GEM cons GEM cons ann GSNAP GSNAP ann GSTRUCT GSTRUCT ann MapSplice MapSplice ann PALMapper PALMapper ann PALMapper cons PALMapper cons ann PASS PASS cons ReadsMap SMALT STAR 1 − pass STAR 1 − pass ann STAR 2 − pass STAR 2 − pass ann TopHat1 TopHat1 ann TopHat2 TopHat2 ann 0 20 40 60 80 100 0 5 10 15 0 20 40 60 80 100 0 5 10 15 Percent of simulated spliced reads Percent of simulated spliced reads Percent of simulated spliced reads Percent of simulated spliced reads Perfectly mapped Part correctly mapped Mapped, no base correct No base correcly mapped but intersecting correct location High ¡accuracy ¡at ¡mapping ¡to ¡correct ¡locus: ¡GSNAP, ¡GSTRUCT, ¡MapSplice, ¡STAR ¡ ¡ High ¡rate ¡of ¡perfect ¡spliced ¡alignments: ¡ReadsMap, ¡TopHat2 ¡ann ¡ ¡ Engström ¡et ¡al. ¡ Nature ¡Methods ¡ 2013 ¡ ¡

Major ¡differences ¡in ¡indel ¡frequencies ¡ a BAGET ann 14.46 13.07 GEM ann 83.32 29.12 GEM cons 85.76 29.51 GEM cons ann 84.91 29.39 GSNAP 5.80 10.25 GSNAP ann 4.84 8.97 GSTRUCT 4.94 9.16 GSTRUCT ann 4.90 9.12 MapSplice 1.65 4.98 MapSplice ann 1.65 5.00 PALMapper 31.54 61.71 PALMapper cons 0.68 0.30 PASS 2.44 4.95 PASS cons 2.38 4.77 ReadsMap 2.70 4.48 SMALT 8.91 9.92 STAR 1 − pass 2.00 4.14 STAR 1 − pass ann 2.03 4.50 STAR 2 − pass 2.02 4.37 STAR 2 − pass ann 2.02 4.50 TopHat1 2.05 7.29 TopHat1 ann 2.05 7.33 TopHat2 6.71 6.09 TopHat2 ann 5.86 6.94 0 20 40 60 80 100 0 20 40 60 80 100 Insertions (%) Deletions (%) Indel size (bases): 1 2 3 4 5–7 8+ Indel ¡frequencies ¡are ¡tabulated ¡(number ¡of ¡indels ¡per ¡thousand ¡sequenced ¡reads). ¡Data ¡set: ¡K562 ¡(mean). ¡ ¡ Engström ¡et ¡al. ¡ Nature ¡Methods ¡ 2013 ¡