introduction to syngenta
play

Introduction to Syngenta Classification: EXTERNAL USE 2014 Who is - PowerPoint PPT Presentation

Dec 18, 2023 •42 likes •102 views

Introduction to Syngenta Classification: EXTERNAL USE 2014 Who is Syngenta? World-leading agri-business - Sales of $14.7bn Through the - Global leader in crop protection eyes of the grower - Third in high-value commercial seeds

  1. Introduction to Syngenta Classification: EXTERNAL USE 2014

  2. Who is Syngenta? ● World-leading agri-business - Sales of $14.7bn Through the - Global leader in crop protection eyes of the grower - Third in high-value commercial seeds ● World-class science - $1.4 billion R&D investments in 2013 Seeds Seed Care - 5,000 R&D people around the world With the broadest portfolio ● Global reach and experience in the industry - Over 27,000 employees in some 90 countries Crop Lawn - Focus on delivering integrated solutions Protection and Garden 2 Classification: EXTERNAL USE

  3. How do we access innovation? Syngenta R&D Collaborations Syngenta Ventures Technology Innovation Toolkit Licensing M&A 3 Classification: EXTERNAL USE

  4. What are we looking for? 2 1 3 Three main themes: 1 2 3 Strategic Ag R&D Platform Technologies Adjacencies • • • Technologies and products that Technologies that support and Technologies and products that are directly related to Syngenta’s complement Syngenta’s R&D are indirectly related to Syngenta’s business capabilities business 4 Classification: EXTERNAL USE

  5. What are some example areas of interest? 1 2 3 Strategic Ag R&D Platform Technologies Adjacencies • • • Novel crop protection chemistry Formulation technologies Digital / big-data • • • Seed genetics Application technologies Crop modelling • • • Trait discovery Phenotyping technologies for field, Farm management software greenhouse and lab • • Seed technologies (seed coating and Sales and marketing tools • dust reduction, seed priming etc) Omics (genomics, proteomics, • Financial and insurance solutions metabolomics, epigenetics etc) • Breeding technologies (hybridization • Product authentication and traceability • systems, quantitative genetics etc) Genome engineering (plant • transformation, recombination, trait Mechanisation • Biologicals / bio-controls stacking, RNAi etc) • Smallholder solutions • Weed control • Expression technologies • Analytical techniques (small molecule, protein, polymer) • Logistics (seed sowing, liquid handling, sample handling, data capture) • Modelling (chemical design, environmental studies, field resistance) • Chemical process technology 5 Classification: EXTERNAL USE

  6. How to contact us If you are seeking partnership or collaboration opportunities: Visit: www.syngentathoughtseeders.com If you are seeking venture capital investment: Email: syngenta.ventures@syngenta.com 6 Classification: EXTERNAL USE

Download Presentation
Download Policy: The content available on the website is offered to you 'AS IS' for your personal information and use only. It cannot be commercialized, licensed, or distributed on other websites without prior consent from the author. To download a presentation, simply click this link. If you encounter any difficulties during the download process, it's possible that the publisher has removed the file from their server.

Recommend

Corporate Responsibility performance 2012 At Syngenta, Corporate Responsibility (CR) Contents

Corporate Responsibility performance 2012 At Syngenta, Corporate Responsibility (CR) Contents

CR performance Corporate Responsibility performance 2012 At Syngenta, Corporate Responsibility (CR) Contents is an integral part of everything we do. Syngenta is guided by the conviction that About our CR reporting 02 value creation depends

661 views • 36 slides
Notice of the General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017 Basel,

Notice of the General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017 Basel,

Notice of the General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017 Basel, Switzerland To the holders of American Depositary Shares (ADSs) of Syngenta AG Notice of the 2017 General Meeting of Shareholders The Bank of New York

209 views • 16 slides
Notice of the Annual General Meeting of Syngenta AG Tuesday April 26, 2016 Basel Switzerland

Notice of the Annual General Meeting of Syngenta AG Tuesday April 26, 2016 Basel Switzerland

Notice of the Annual General Meeting of Syngenta AG Tuesday April 26, 2016 Basel Switzerland Basel, March 16, 2016 To the holders of American Depositary Shares (ADSs) of Syngenta AG Notice of the Annual General Meeting 2016 The Bank of

400 views • 12 slides
About the project Six acre site leased from Syngenta for community use 400 tree orchard and

About the project Six acre site leased from Syngenta for community use 400 tree orchard and

About the project Six acre site leased from Syngenta for community use 400 tree orchard and half acre vineyard, 1000 tree saplings Barn storage, welfare room, toilets, office, polytunnel Independent access, car parking, accessible

275 views • 5 slides
Chairman s speech Michel Demar, Chairman of the Board of Directors Dear shareholders,

Chairman s speech Michel Demar, Chairman of the Board of Directors Dear shareholders,

Check against delivery June 26, 2017, Basel, Switzerland General Meeting Syngenta AG Chairman s speech Michel Demar, Chairman of the Board of Directors Dear shareholders, Ladies and gentlemen, 2016 was a momentous year for Syngenta and

569 views • 3 slides
Thomas P. Redick Gene Editing RT7 October 24, 2017 NC Biotechnology Center Background:

Thomas P. Redick Gene Editing RT7 October 24, 2017 NC Biotechnology Center Background:

Thomas P. Redick Gene Editing RT7 October 24, 2017 NC Biotechnology Center Background: Starlink & Liberty Link Facts of Viptera Corn Launch by Syngenta Major Issues to Raised in 2017 Syngenta Trial & up to $1.5 Billion

400 views • 24 slides
Managing Next Generation Sequence Data at Syngenta with iRODS Todd Moughamer Classification:

Managing Next Generation Sequence Data at Syngenta with iRODS Todd Moughamer Classification:

Managing Next Generation Sequence Data at Syngenta with iRODS Todd Moughamer Classification: PUBLIC iRODS UGM 2018 Durham, NC June 6 & 7, 2018 Who we are A leading agriculture company helping 90 to improve global food security by

423 views • 13 slides
Invitation General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017, 2:30 p.m.

Invitation General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017, 2:30 p.m.

Invitation General Meeting of Shareholders of Syngenta AG Monday, June 26, 2017, 2:30 p.m. Congress Center Basel, Messeplatz 21, 4058 Basel Basel, May 15, 2017 Message from the Chairman Dear shareholders, I herewith invite you to the General

485 views • 20 slides
Syngenta AG H1 2020 Financial Results July 22, 2020 Classification: PUBLIC Cautionary statement

Syngenta AG H1 2020 Financial Results July 22, 2020 Classification: PUBLIC Cautionary statement

Syngenta AG H1 2020 Financial Results July 22, 2020 Classification: PUBLIC Cautionary statement regarding forward-looking statements Some of the statements contained in this document are forward-looking statements. These statements are based

372 views • 13 slides
Invitation Annual General Meeting Tuesday, April 29, 2014, 9.30 a.m. St. Jakobshalle Basel

Invitation Annual General Meeting Tuesday, April 29, 2014, 9.30 a.m. St. Jakobshalle Basel

Invitation Annual General Meeting Tuesday, April 29, 2014, 9.30 a.m. St. Jakobshalle Basel Syngenta 1 Invitation 2014 Basel, March 19, 2014 Dear shareholders, We are pleased to invite you to the Annual General Meeting of Syngenta AG which

644 views • 18 slides
Invitation Annual General Meeting Tuesday, April 23, 2013, 10.00 a.m. St. Jakobshalle Basel

Invitation Annual General Meeting Tuesday, April 23, 2013, 10.00 a.m. St. Jakobshalle Basel

Invitation Annual General Meeting Tuesday, April 23, 2013, 10.00 a.m. St. Jakobshalle Basel Syngenta 1 Invitation 2013 Basel, March 13, 2013 Dear shareholders, We are pleased to invite you to the Annual General Meeting of Syngenta AG, which

440 views • 14 slides
Invitation Annual General Meeting Tuesday, April 24, 2012, 10.00 a.m. Congress Center Basel

Invitation Annual General Meeting Tuesday, April 24, 2012, 10.00 a.m. Congress Center Basel

Invitation Annual General Meeting Tuesday, April 24, 2012, 10.00 a.m. Congress Center Basel Syngenta 1 Invitation 2012 Basel, March 14, 2012 Dear shareholders, We are pleased to invite you to the Annual General Meeting of Syngenta AG, which

545 views • 18 slides
Kilimo Salama: Micro Crop Insurance through mobile Eric Seuret, 26 November 2010, Bern Overview

Kilimo Salama: Micro Crop Insurance through mobile Eric Seuret, 26 November 2010, Bern Overview

Kilimo Salama: Micro Crop Insurance through mobile Eric Seuret, 26 November 2010, Bern Overview 1. Introduction and Background 1. Syngenta Foundation for Sustainable Agriculture 2. Why do farmers need insurance? 3. What is weather index

181 views • 16 slides
INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION

INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION

TRAINING COURSE ON SOCIAL PROTECTION & FORMALIZATION TRINIDAD AND TOBAGO MARCH 15, 2017 INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION INTRODUCTION Design of the NIS Assistance from the

547 views • 23 slides
Toxicokinetics modelling in Ecotoxicology and Ecological Risk Assessment Agnieszka Bednarska (1) ,

Toxicokinetics modelling in Ecotoxicology and Ecological Risk Assessment Agnieszka Bednarska (1) ,

Toxicokinetics modelling in Ecotoxicology and Ecological Risk Assessment Agnieszka Bednarska (1) , Peter Edwards (1) , Richard Sibly (2) , Pernille Thorbek (1) (1) Syngenta, Jealotts Hill International Research Centre, Bracknell (2) School of

204 views • 19 slides
Chief Executive Officers speech Mike Mack, CEO Good morning. The last three years have been a

Chief Executive Officers speech Mike Mack, CEO Good morning. The last three years have been a

Check Against Delivery April 29, 2014, Basel, Switzerland Annual General Meeting Syngenta AG Chief Executive Officers speech Mike Mack, CEO Good morning. The last three years have been a time of intense activity at our company. We have

119 views • 9 slides
Program logics for relaxed consistency UPMARC Summer School 2014 Viktor Vafeiadis Max Planck

Program logics for relaxed consistency UPMARC Summer School 2014 Viktor Vafeiadis Max Planck

Program logics for relaxed consistency UPMARC Summer School 2014 Viktor Vafeiadis Max Planck Institute for Software Systems (MPI-SWS) 2nd Lecture, 29 July 2014 Recap Topics covered yesterday: The C11 memory model Separation logic

377 views • 34 slides
One year of developments and collaborations around the MinION on the Genomic facility of the

One year of developments and collaborations around the MinION on the Genomic facility of the

One year of developments and collaborations around the MinION on the Genomic facility of the IBENS. Laurent Jourdren (CNRS IBENS) Sophie Lemoine (CNRS IBENS) Brengre Laffay (CNRS IBENS) December 13 th , 2017 Gnoscope, vry

662 views • 22 slides
The Ensemble of RNA Structures Example: best structures of the RNA sequence

The Ensemble of RNA Structures Example: best structures of the RNA sequence

The Ensemble of RNA Structures Example: best structures of the RNA sequence GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCCCUGGUUCAAAUCCAGGUGCCCCCU free energy in kcal/mol (((((((..((((.......))))...........((((....))))(((((.......)))))))))))).

686 views • 41 slides
I/O monotone dynamical systems Germn A. Enciso University of California, Irvine Eduardo

I/O monotone dynamical systems Germn A. Enciso University of California, Irvine Eduardo

I/O monotone dynamical systems Germn A. Enciso University of California, Irvine Eduardo Sontag, Rutgers University May 25 rd , 2011 BEFORE: Santa Barbara, January 2003 Having handed to me a photocopied paper by one Morris Hirsch, to be

641 views • 26 slides
Roach Master: Putting it all together Mohammad T . Irfan 10/29/2013 What we want Want to

Roach Master: Putting it all together Mohammad T . Irfan 10/29/2013 What we want Want to

10/29/2013 Roach Master: Putting it all together Mohammad T . Irfan 10/29/2013 What we want Want to create hundreds of roaches, each of which has a head, a body, and two antennas, with different initial locations and different speeds

317 views • 16 slides
Intro to SKARAB for programmers (and how to use HMC!) Jason Manley 2017 CASPER workshop

Intro to SKARAB for programmers (and how to use HMC!) Jason Manley 2017 CASPER workshop

Intro to SKARAB for programmers (and how to use HMC!) Jason Manley 2017 CASPER workshop Hardware Hardware Virtex 7, 690T FPGA 4 Mezzanine sites per SKARAB 2 in front, 2 in back 16 SERDES links per site Designed to

266 views • 22 slides
Draft-ietf-anima-bootstrapping-keyinfra Versions 24-30 IETF 106 Singapore Slides from:

Draft-ietf-anima-bootstrapping-keyinfra Versions 24-30 IETF 106 Singapore Slides from:

Draft-ietf-anima-bootstrapping-keyinfra Versions 24-30 IETF 106 Singapore Slides from: Michael Richardson mcr+ietf@sandelman.ca Status of BRSKI Edits for Adam Revision to Roach review Christian Huiteam IESG review SECDIR review IESG

361 views • 9 slides
A Model of the Current Account Costas Arkolakis teaching fellow: Federico Esposito Economics

A Model of the Current Account Costas Arkolakis teaching fellow: Federico Esposito Economics

A Model of the Current Account Costas Arkolakis teaching fellow: Federico Esposito Economics 407, Yale January 2014 A Model of Current Account Determination The Model and the National Accounts The Formal Model Modeling the

684 views • 51 slides

More recommend