- M. Obermeier 5/2013
HIV-1 Tropism – Arevir workshop
Martin Obermeier Specialist for laboratory medicine Associate Medical center for infectious diseases Berlin – Germany
HIV-1 Tropism Arevir workshop Martin Obermeier Specialist for - - PowerPoint PPT Presentation
HIV-1 Tropism Arevir workshop Martin Obermeier Specialist for laboratory medicine Associate Medical center for infectious diseases Berlin Germany M. Obermeier 5/2013 Targets for HIV drug therapy plasma RNA proviral DNA Adapted
Martin Obermeier Specialist for laboratory medicine Associate Medical center for infectious diseases Berlin – Germany
plasma RNA proviral DNA
Adapted from http://www.nature.com/embor/journal/v4/n6s/fig_tab/embor857_f2.html
6558 TGGGATCAAAGCCTAAAGCCATGTG
GGGTTCTTRGGAGCAGCAGGAAGCACT 7785
6957 GTACAATGTACACATGGAAT
TAATTGTGGAGGGGAATTTT 7371
V3
Genotypic approach for coreceptor-detection
http://www.hiv.lanl.gov/content/hiv-db/MAP/landmark.html
Probability with which a CCR5-tropic virus is falsely classified as CXCR4-tropic
www.geno2pheno.org
50 yo male HIV diagnosis 07/1995 Treatment history 7/95 - 1/96: AZT + 3TC 1/96 - 7/96: AZT + 3TC + SQV-hgc 7/96 - 9/96: AZT + 3TC + IDV 9/96 - 8/97: d4T + ddI + IDV 8/97 - 10/97: d4T + ddC + IDV 10/97 - 2/98: d4T + ddC + SQV-sgc + RTV 2/98 - 1/00: d4T + ddC + SQV-sgc + RTV + NVP 1/00 - 7/00: CBV + ABC + APV 7/00 – 9/03: TZV + APV + RTV 9/03 – 12/05: d4T + TDF + LPV/RTV 12/05 – 10/07: ABC/3TC/AZT + TDF + TPV +RTV
Protease: L10V, K20V, L33V, M36I, M46I, G48V, I54S, A71I, V82AT, I84V
3TC + DRV/ r Genotype: CCR5
3TC + DRV/ r + MVC
phenotype: D/M
genotype: CCR5 phenotype: D/ M 3TC + DRV/ r 3TC + DRV/ r + MVC
R5 X4
R5 X4 X4-prediction method A
R5 X4 X4-prediction method B
38 years old, male HIV diagnosis 1986, Risk MSM Begin of first ART: 1998 ART-experience: 3TC, ABC, d4T,
TDF, FTC, NVP, EFV, SQV, Lopinavir, Ritonavir (fulldose and booster), Darunavir
Last cART: TDF/FTC + NVP
No tropism testing from viral RNA
possible
Tropism testing from proviral DNA:
CCR5-tropic (FPR 31%)
Genotypic Resistance: No drug
resistance associated mutations
Switch to MVC + RAL
Integrase-gene: N155H CXCR4-Tropism detected from viral
RNA (FPR: 0.1%)
But: In overall cohort 6 Patients with dual
treatment Maraviroc and Raltegravir
4 Patients show a viral load <50
cop/ml ant week 48
Maraviroc plus Raltegravir dual Therapy in Aviremic
HIV infected Patients with Lipodystrophy : Results from the ROCnRAL ANRS 157 Study. Katlama et al. CROI 2013 #566
type B or CRF02 HIV-1. ≥ 18 years old ART for at least 5 years, and stable ART for at least 6
months.
HIV-RNA < 200 copies/mL over the last 24 months,
and < 50 copies/mL for at least 12 months. •R5 tropic virus on HIV-DNA and with CD4 nadir ≥ 100/mm3 OR R5 tropic virus on HIV-DNA (FPR >20%) and HIV-RNA
load.
Clinical lipohypertrophy and defined by increased
volume of the abdominal and/or thoracic and/or cervical area (buffalo hump).
Naïve for raltegravir and maraviroc.
We need to collect more data